URL: http://www.addgene.org/45126
Proper Citation: RRID:Addgene_45126
Insert Name: Id1-BRE
Bacterial Resistance: Ampicillin
Defining Citation: PMID:11729207
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase, BMP/Smad Transcriptional Reporter; Bacterial Resistance:Ampicillin
Comments: Synthetic oligonucleotides containing two CAGC sites, GGCGCC palindrome and MluI 5′-overhang (on the sense strand) and two SBE sites, one GGCG site and NheI 5′-overhang (on the antisense strand) were ligated and inserted into NheI sites in pGL3-MLP-luc minimal promoter vector. Thus the construct was created with a 5′ site for NheI site followed by 2 SBEs, 1 GGCG site, 2 CAGC′ sites, 2 GGCGCC palindromes, 2 CAGC′ sites, 1 GGCG site, 2 SBEs, and an NheI 3′ site. Based on the above description and the associated publication, the deduced sequence of the full hairpin is: GCTAGCTCAGACCGTTAGACGCCAGGACGGGCTGTCAGGCTGGCGCCG CGGCGCCAGCCTGACAGCCCGTCCTGGCGTCTAACGGTCTGAGCTAGC The presence of the hairpin can make sequencing this region difficult by traditional Sanger Sequencing. Protocols for "difficult templates" or "GC rich" may help.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pGL3 BRE Luciferase.
No alerts have been found for pGL3 BRE Luciferase.
Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org