URL: http://www.addgene.org/33149
Proper Citation: RRID:Addgene_33149
Insert Name: RP51A-synthetic minimal intron
Organism: Saccharomyces cerevisiae
Bacterial Resistance: Ampicillin
Defining Citation: PMID:2655924
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLG-Sty.
No alerts have been found for pLG-Sty.
Source: Addgene