URL: http://www.addgene.org/29662
Proper Citation: RRID:Addgene_29662
Bacterial Resistance: Kanamycin
Defining Citation: PMID:
Vector Backbone Description: Backbone Size:5340; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable FLAG fusion tag on its N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET Flag TEV LIC cloning vector (1L).
No alerts have been found for pET Flag TEV LIC cloning vector (1L).
Source: Addgene