You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/29654.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_29654 RRID Copied  
PDF Report How to cite
RRID:Addgene_29654
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/29654

Proper Citation: RRID:Addgene_29654

Insert Name: None

Bacterial Resistance: Kanamycin

Vector Backbone Description: Backbone Size:6507; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. MBP can enhance the expression and solubility of your protein of interest. The long poly-Asn linker may help avoid steric clashes between your protein and MBP. If a shorter linker is desired, please use vector 1M. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pET His6 MBP Asn10 TEV LIC cloning vector (1C).

No alerts have been found for pET His6 MBP Asn10 TEV LIC cloning vector (1C).

Data and Source Information

Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org