URL: http://www.addgene.org/27368
Proper Citation: RRID:Addgene_27368
Insert Name: shYAP1
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:18579750
Vector Backbone Description: Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLKO1-shYAP1.
No alerts have been found for pLKO1-shYAP1.
Source: Addgene