URL: http://www.addgene.org/26818
Proper Citation: RRID:Addgene_26818
Insert Name: 5'UTR-c-MYC-3'UTR
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:20888316
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Note that orientation of the insert in pcDNA does not matter -- they were cloned by TA-cloning, and either orientation is fine. Comment from lab: "with reference to NM_002467.4 sequence we have two mutations at following positions: 172 (A to G) and 174 (C to G) there is some confusion as to what the ref seq is exactly but these are the constructs that we've been using successfully." Please note that the 5'UTR and 3'UTR sequences are synthetic and were added to the c-MYC ORF as described in Figure S1 and Table S2 of Warren et al., Cell Stem Cell. 2010. These UTR sequences are not endogenous c-MYC UTR sequences. The 5' UTR sequence (including T7 promoter) is: TGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAG AGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG The 3' UTR sequence is: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCT CCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAA GTGAGGGTCTAGAACTAGTGTCGACGC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pcDNA3.3_c-MYC.
No alerts have been found for pcDNA3.3_c-MYC.
Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org