URL: http://www.addgene.org/26731
Proper Citation: RRID:Addgene_26731
Insert Name: Hypoxia Responsive Elements (3)
Bacterial Resistance: Ampicillin
Defining Citation: PMID:18268343
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:0; Vector Backbone:pGL2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Comments: Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase. HRE: TGTCACGTCCTGCACGACTCTAGT Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function.
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for HRE-luciferase.
No alerts have been found for HRE-luciferase.
Source: Addgene