URL: http://www.addgene.org/24349
Proper Citation: RRID:Addgene_24349
Insert Name: 5xQUAS-Pmin promoter
Organism: Drosophila melanogaster
Bacterial Resistance: Ampicillin
Defining Citation: PMID:20434990
Vector Backbone Description: Backbone Marker:Brand and Perrimon, 1993; Backbone Size:8950; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This vector was designed to mimic the multi-cloning site of the pUAST vector (Brand and Perrimon, 1993) thereby allowing easy exchange of inserts between pUAST and pQUAST. pUAST was digest by SphI and EcoRI and blunted with Klenow to remove the 5xUAS and hsp70 minimal promoter (minP). pQUAS-GG was digested with BamHI and EcoRI to excise the 5xQUAS and Pmin and then blunted. The 5xQUAS-Pmin promoter was then ligated into the modified pUAST vector to generate pQUAST. Any gene X can be subcloned from pUAST-geneX into pQUAST using the same restriction sites that were originally utilized for pUAST-geneX construction. If the pUAST- geneX plasmid is not available, genomic DNA from flies containing the UAS-geneX transgene can be used. In this case, pQUAST-geneX can be constructed as follows: 1) PCR amplify the UAS insert from UAS-geneX genomic DNA by using the primer pairs genUASFOR (GCTTCGTCTACGGAGCGACAATTCAATTCAAAC) and genUASREVsv40 (GCAGTAGCCTCATCATCACTAGATGGCATTTCTTC). These primers will amplify the insert for any UAS construct, including the restriction sites used for cloning of that insert into the UAS vector. 2) If the restriction sites used for cloning of the UAS insert are unknown, sequence the PCR fragment using UASFOR-SEQ (TCAAACAAGCAAAGTGAACACG) and SV40REV-SEQ (CCATTCATCAGTTCCATAGGTTGG) primers. 3) Digest the PCR product with appropriate enzymes for cloning into pQUAST.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pQUAST.
No alerts have been found for pQUAST.
Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org