URL: http://www.addgene.org/15257
Proper Citation: RRID:Addgene_15257
Insert Name: v-ral simian leukemia viral oncogene homolog A
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:17540176
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: Target sequence: CGCTGCAATTAGAGACAACTACT
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLKO.1-shRalA-1.
No alerts have been found for pLKO.1-shRalA-1.
Source: Addgene