You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/66823.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_66823 RRID Copied  
PDF Report How to cite
RRID:Addgene_66823
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/66823

Proper Citation: RRID:Addgene_66823

Insert Name: GFP-C1^SEC^3xFlag

Organism: Caenorhabditis elegans

Bacterial Resistance: Ampicillin

Defining Citation: PMID:26044593

Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin

Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined. Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]

Expand All
Usage and Citation Metrics
We apologize, the data for 2022 is currently unavailable for most resources. We are aware of the issue and are working to resolve it.

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pDD282.

No alerts have been found for pDD282.

Data and Source Information

Source: Addgene