You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/37237.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_37237 RRID Copied  
PDF Report How to cite
RRID:Addgene_37237
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/37237

Proper Citation: RRID:Addgene_37237

Bacterial Resistance: Ampicillin

Defining Citation: PMID:

Vector Backbone Description: Backbone Size:5898; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2Cc-T has a TEV-cleavable C-terminal MBP tag to enhance solubility, as well as a His6 tag to ease purification. The TEV site is created after performing LIC cloning described below. To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers. Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3' Reverse - 5'GGATTGGAAGTAGAGGTTCTC3' Linearize the plasmid with HpaI and gel purify. When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pET MBP His6 LIC cloning vector (2Cc-T).

No alerts have been found for pET MBP His6 LIC cloning vector (2Cc-T).

Data and Source Information

Source: Addgene