You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/32530.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_32530 RRID Copied  
PDF Report How to cite
RRID:Addgene_32530
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/32530

Proper Citation: RRID:Addgene_32530

Bacterial Resistance: Ampicillin

Defining Citation: PMID:

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Comments: Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag. Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.

Expand All
Usage and Citation Metrics
We apologize, the data for 2022 is currently unavailable for most resources. We are aware of the issue and are working to resolve it.

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pCMV-HA (New MCS).

No alerts have been found for pCMV-HA (New MCS).

Data and Source Information

Source: Addgene