URL: http://www.addgene.org/30323
Proper Citation: RRID:Addgene_30323
Insert Name: GFP shRNA
Bacterial Resistance: Ampicillin
Defining Citation: PMID:18497260
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: shRNA directed against GFP (Target sequence: 5'GCAAGCTGACCCTGAAGTTCAT3'). Used as control shRNA.
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLKO.1 GFP shRNA.
No alerts have been found for pLKO.1 GFP shRNA.
Source: Addgene