You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.addgene.org/26656.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Plasmid Name
RRID:Addgene_26656 RRID Copied  
PDF Report How to cite
RRID:Addgene_26656
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/26656

Proper Citation: RRID:Addgene_26656

Bacterial Resistance: Ampicillin

Defining Citation: PMID:9514715

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601". Primers that are used by the Widom lab to amplify the 147 bp fragment: Forward: ctggagaatcccggtgccg Reverse: acaggatgtatatatctgacacg Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pGEM-3z/601.

No alerts have been found for pGEM-3z/601.

Data and Source Information

Source: Addgene