URL: http://www.addgene.org/26656
Proper Citation: RRID:Addgene_26656
Bacterial Resistance: Ampicillin
Defining Citation: PMID:9514715
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601". Primers that are used by the Widom lab to amplify the 147 bp fragment: Forward: ctggagaatcccggtgccg Reverse: acaggatgtatatatctgacacg Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pGEM-3z/601.
No alerts have been found for pGEM-3z/601.
Source: Addgene