URL: http://www.addgene.org/135094
Proper Citation: RRID:Addgene_135094
Insert Name: sgRNA for cxTi10082 (actgttggatgcctgtgtag)
Organism: Caenorhabditis elegans
Bacterial Resistance: Ampicillin
Defining Citation: PMID:31378567
Vector Backbone Description: Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCZGY2750.
No alerts have been found for pCZGY2750.
Source: Addgene