URL: http://www.addgene.org/26597
Proper Citation: RRID:Addgene_26597
Insert Name: control shRNA
Bacterial Resistance: Ampicillin
Defining Citation: PMID:20197401
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: Control shRNA: AATAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTATTTTTTTT
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pSIH1-puro-control shRNA.
No alerts have been found for pSIH1-puro-control shRNA.
Source: Addgene