Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037915
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017816(hrpk-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017816(hrpk-1)
Availability: available
Source References: EMPTY
Synonyms: hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Alternate IDs: WB-STRAIN:VC4098, CGC_VC4098
Notes: Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037915 Copy
http://www.wormbase.org/db/get?name=WBStrain00033905
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:8514128
Synonyms: dpy-5(e61) unc-13(e51) I; gaDp1 (I;f).
Alternate IDs: WB-STRAIN:SD63, CGC_SD63
Notes: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Maintain by picking WT.
Proper citation: RRID:WB-STRAIN:WBStrain00033905 Copy
http://www.wormbase.org/db/get?name=WBStrain00034126
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.
Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy
http://www.wormbase.org/db/get?name=WBStrain00034439
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003221(mes-3)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003221(mes-3)
Availability: available
Source References: PMID:1783292
Synonyms: mes-3(bn35) dpy-5(e61) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:SS262, CGC_SS262
Notes: Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.
Proper citation: RRID:WB-STRAIN:WBStrain00034439 Copy
http://www.wormbase.org/db/get?name=WBStrain00062741
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00062741 Copy
http://www.wormbase.org/db/get?name=WBStrain00052039
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004268(rab-5)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004268(rab-5)
Availability: unknown
Source References: EMPTY
Synonyms: rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I.
Notes: Made_by: UDN Screening Center|"rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658"
Proper citation: RRID:WB-STRAIN:WBStrain00052039 Copy
http://www.wormbase.org/db/get?name=WBStrain00055739
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002."
Proper citation: RRID:WB-STRAIN:WBStrain00055739 Copy
http://www.wormbase.org/db/get?name=WBStrain00054788
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006751(unc-11)
Availability: unknown
Source References: EMPTY
Synonyms: gld-1(q343)/unc-11(e47) dpy-5(e61) I
Notes: Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.
Proper citation: RRID:WB-STRAIN:WBStrain00054788 Copy
http://www.wormbase.org/db/get?name=WBStrain00000478
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
Source References: PMID:492325
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180) I.
Alternate IDs: WB-STRAIN:BC196, CGC_BC196
Notes: Dpy. Best maintained at 16C (dpy-14 is ts). High recombination.
Proper citation: RRID:WB-STRAIN:WBStrain00000478 Copy
http://www.wormbase.org/db/get?name=WBStrain00000471
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:6593563
Synonyms: dpy-5(e61) unc-13(e51) I; sDp1 (I;f).
Alternate IDs: WB-STRAIN:BC159, CGC_BC159
Notes: Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Segregates 2% males. The males are sterile. The duplication is homozygous lethal.|"Mutagen:Gamma ray"
Proper citation: RRID:WB-STRAIN:WBStrain00000471 Copy
http://www.wormbase.org/db/get?name=WBStrain00000418
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00004960(spe-6)|WBGene00004966(spe-12)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00004960(spe-6), WBGene00004966(spe-12)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) spe-12(hc76) I; spe-6(hc163) III.
Alternate IDs: WB-STRAIN:BA979, CGC_BA979
Notes: spe-6(hc163) suppresses hermaphrodite self-sterility of hc76. Dpy.
Proper citation: RRID:WB-STRAIN:WBStrain00000418 Copy
http://www.wormbase.org/db/get?name=WBStrain00001149
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx900.
Alternate IDs: WB-STRAIN:BC10066, CGC_BC10066
Notes: Made_by: Reza Pourvali|"sEx900 [rCesC15H9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00001149 Copy
http://www.wormbase.org/db/get?name=WBStrain00001143
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: PMID:31704915
Synonyms: dpy-5(e907) I; sEx884.
Alternate IDs: WB-STRAIN:BC10060, CGC_BC10060
Notes: Made_by: Reza Pourvali|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."|"sEx884 [rCesC12C8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00001143 Copy
http://www.wormbase.org/db/get?name=WBStrain00001145
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx890.
Alternate IDs: WB-STRAIN:BC10062, CGC_BC10062
Notes: Made_by: Reza Pourvali|"sEx890 [rCesF11F1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00001145 Copy
http://www.wormbase.org/db/get?name=WBStrain00001160
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx10089.
Alternate IDs: WB-STRAIN:BC10089, CGC_BC10089
Notes: sEx10089 [rCesF22E10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00001160 Copy
http://www.wormbase.org/db/get?name=WBStrain00001156
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001748(gsp-2)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001748(gsp-2)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx10077.
Alternate IDs: WB-STRAIN:BC10077, CGC_BC10077
Notes: sEx10077 [rCesF56C9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00001156 Copy
http://www.wormbase.org/db/get?name=WBStrain00001174
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx10116.
Alternate IDs: WB-STRAIN:BC10116, CGC_BC10116
Notes: sEx10116 [rCesF56B6.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00001174 Copy
http://www.wormbase.org/db/get?name=WBStrain00001173
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00009772(ztf-7)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00009772(ztf-7)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx10113.
Alternate IDs: WB-STRAIN:BC10113, CGC_BC10113
Notes: sEx10113 [rCesF46B6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00001173 Copy
http://www.wormbase.org/db/get?name=WBStrain00001169
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx10105.
Alternate IDs: WB-STRAIN:BC10105, CGC_BC10105
Notes: sEx10105 [rCesZk470.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00001169 Copy
http://www.wormbase.org/db/get?name=WBStrain00001165
Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00016140(rpb-2)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00016140(rpb-2)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e907) I; sEx10100.
Alternate IDs: WB-STRAIN:BC10100, CGC_BC10100
Notes: sEx10100 [rCes C26E6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00001165 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within nidm-terms that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
