Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RM1677
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033384 Caenorhabditis elegans unc-41(md152) V. unc-41(md152) is a 1 bp deletion after amino acid 872 in exon 8 producing GLHKS*. wt sequence: GCTAACTCTTGTGCAGCCCG. md152 sequence: GCTAACTCTTGTGCAGCCCA. WBGene00006777(unc-41) WBGene00006777(unc-41) WB-STRAIN:WBStrain00033384 WormBase (WB) WB unknown WB-STRAIN:RM1677 2026-09-12 11:16:54 0
RM1702
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033385 Caenorhabditis elegans ric-8(md303) IV. Made_by: J. Rand/K. Miller|"Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C." WBGene00004367(ric-8) WBGene00004367(ric-8) WB-STRAIN:WBStrain00033385 WormBase (WB) WB available PMID:8901627 WB-STRAIN:RM1702, CGC_RM1702 2026-09-12 11:16:54 0
RM1845
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033387 Caenorhabditis elegans cat-1(e1111) X. Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes. WBGene00000295(cat-1) WBGene00000295(cat-1) WB-STRAIN:WBStrain00033387 WormBase (WB) WB available WB-STRAIN:RM1845, CGC_RM1845 2026-09-12 11:16:54 0
RM2037
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033389 Caenorhabditis elegans unc-17(e245) cho-1(tm373) IV. Loosely-linked (~12 cM apart) cholinergic mutants. Aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. cho-1(tm373) is a null deletion allele of the gene encoding the plasma membrane choline transporter, and unc-17(e245) is a strong missense allele of the synaptic vesicle acetylcholine transporter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.|"Made_by: Mai Vu" WBGene00000501(cho-1)|WBGene00006756(unc-17) WBGene00000501(cho-1), WBGene00006756(unc-17) WB-STRAIN:WBStrain00033389 WormBase (WB) WB available WB-STRAIN:RM2037, CGC_RM2037 2026-09-12 11:16:54 0
RM2431
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033392 Caenorhabditis elegans unc-13(md2415)/hT1 I; +/hT1 V. Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the unc-13R region.|"Made_by: Moulder/Eustance-Koh"|"Mutagen: Psoralen"|"Supplementary_genotype unc-13(md2415)/hT1 I; +/hT1 V." WBGene00006752(unc-13) WBGene00006752(unc-13) WB-STRAIN:WBStrain00033392 WormBase (WB) WB available PMID:36617680 WB-STRAIN:RM2431, CGC_RM2431 2026-09-12 11:16:54 0
RE666
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033316 Caenorhabditis elegans ire-1(v33) II. Made_by: X. Shen|"Slow growth. Abnormal tail."|"Supplementary_genotype ire-1(v33) II" WBGene00002147(ire-1) WBGene00002147(ire-1) WB-STRAIN:WBStrain00033316 WormBase (WB) WB available PMID:33542359
PMID:36924492
PMID:39436952
WB-STRAIN:RE666, CGC_RE666 2026-09-12 11:16:53 2
RFK607
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033318 Caenorhabditis elegans gtsf-1(xf43) IV. Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. WBGene00020286(gtsf-1) WBGene00020286(gtsf-1) WB-STRAIN:WBStrain00033318 WormBase (WB) WB available WB-STRAIN:RFK607, CGC_RFK607 2026-09-12 11:16:53 0
RFK608
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033319 Caenorhabditis elegans gtsf-1(xf44) IV. Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. WBGene00020286(gtsf-1) WBGene00020286(gtsf-1) WB-STRAIN:WBStrain00033319 WormBase (WB) WB available WB-STRAIN:RFK608, CGC_RFK608 2026-09-12 11:16:53 0
RM2710
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033395 Caenorhabditis elegans snf-11(ok156) V. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"No obvious phenotype."|"Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30." WBGene00004910(snf-11) WBGene00004910(snf-11) WB-STRAIN:WBStrain00033395 WormBase (WB) WB available PMID:31415799 WB-STRAIN:RM2710, CGC_RM2710 2026-09-12 11:16:54 1
RM2711
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033396 Caenorhabditis elegans unc-25(e156) III; snf-11(ok156) V. Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. WBGene00004910(snf-11)|WBGene00006762(unc-25) WBGene00004910(snf-11), WBGene00006762(unc-25) WB-STRAIN:WBStrain00033396 WormBase (WB) WB available WB-STRAIN:RM2711, CGC_RM2711 2026-09-12 11:16:54 0
RC399
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033310 Caenorhabditis elegans mett-10(g38) dpy-18(e364) III. Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42. WBGene00001077(dpy-18)|WBGene00014228(mett-10) WBGene00001077(dpy-18), WBGene00014228(mett-10) WB-STRAIN:WBStrain00033310 WormBase (WB) WB available PMID:7250492 WB-STRAIN:RC399, CGC_RC399 2026-09-12 11:16:53 0
RDV55
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033312 Caenorhabditis elegans rdvIs1 III. rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.|"Supplementary_genotype rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III" WB-STRAIN:WBStrain00033312 WormBase (WB) WB available PMID:37651423
PMID:39525282
WB-STRAIN:RDV55, CGC_RDV55 2026-09-12 11:16:53 0
RL67
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033369 Caenorhabditis elegans lon-1(e185) let-711(it150) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.|"Made_by: L. DeBella/L. Rose" WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00002845(let-711)|WBGene00003055(lon-1)|WBGene00006768(unc-32) WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00002845(let-711), WBGene00003055(lon-1), WBGene00006768(unc-32) WB-STRAIN:WBStrain00033369 WormBase (WB) WB available WB-STRAIN:RL67, CGC_RL67 2026-09-12 11:16:54 0
RG3036
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033362 Caenorhabditis elegans irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of irg-7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018237(irg-7) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018237(irg-7) WB-STRAIN:WBStrain00033362 WormBase (WB) WB available WB-STRAIN:RG3036, CGC_RG3036 2026-09-12 11:16:53 0
RG3039
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033365 Caenorhabditis elegans spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F40F11.4. Insertion site verified by PCR. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, ve539 homozygotes (Ste, lays only oocytes, GFP+ mKate-), Vul nT1 homozygotes (brighter mKate2+) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaactcacAAATAACTTTGTACCG Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAAT" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009589(spe-36) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009589(spe-36) WB-STRAIN:WBStrain00033365 WormBase (WB) WB available WB-STRAIN:RG3039, CGC_RG3039 2026-09-12 11:16:54 0
RG3041
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033366 Caenorhabditis elegans K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of K06A9.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: gaatcacaaaaaattatgttttttt Right flanking sequence: GGAGGGGCACATAGAATCAATCATG" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00033366 WormBase (WB) WB available WB-STRAIN:RG3041, CGC_RG3041 2026-09-12 11:16:54 0
RJP255
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033367 Caenorhabditis elegans ynIs34 IV; him-5(e1490) V. Made_by: unknown|"ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50." WBGene00001864(him-5) WBGene00001864(him-5) WB-STRAIN:WBStrain00033367 WormBase (WB) WB available WB-STRAIN:RJP255, CGC_RJP255 2026-09-12 11:16:54 0
RM2754
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033400 Caenorhabditis elegans dnj-14(ok237) X. Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.|"Made_by: OMRF Knockout Group" WBGene00001032(dnj-14) WBGene00001032(dnj-14) WB-STRAIN:WBStrain00033400 WormBase (WB) WB available WB-STRAIN:RM2754, CGC_RM2754 2026-09-12 11:16:54 1
RK1
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033368 Caenorhabditis elegans unc-13(e323) I; jsIs1. jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.|"Made_by: Guziewicz/Vitullo" WBGene00006752(unc-13) WBGene00006752(unc-13) WB-STRAIN:WBStrain00033368 WormBase (WB) WB available WB-STRAIN:RK1, CGC_RK1 2026-09-12 11:16:54 0
RL104
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033370 Caenorhabditis elegans ifet-1(it149) dpy-17(e164)/qC1 [dpy-19(e1259) glp-1(q339)] III. Heterozygotes are WT and segregate WT and sterile Dpys. Referenced in Li, W. et al. J Cell Bio 187(1):33-42 (2009).|"Made_by: Wei Li / L Rose" WBGene00001076(dpy-17)|WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00004132(ifet-1) WBGene00001076(dpy-17), WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00004132(ifet-1) WB-STRAIN:WBStrain00033370 WormBase (WB) WB available WB-STRAIN:RL104, CGC_RL104 2026-09-12 11:16:54 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.