Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
NL1909 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028981 | Caenorhabditis elegans | acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. | pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. | WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) | WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00028981 | WormBase (WB) | WB | available | WB-STRAIN:NL1909, CGC_NL1909 | 2026-07-25 10:22:29 | 0 | |||
|
NL1921 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028982 | Caenorhabditis elegans | acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. | pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1. | WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) | WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00028982 | WormBase (WB) | WB | available | WB-STRAIN:NL1921, CGC_NL1921 | 2026-07-25 10:22:29 | 0 | |||
|
NL1832 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028976 | Caenorhabditis elegans | T24C4.1(pk732) III. | EMPTY | WBGene00020757(ucr-2.3) | WBGene00020757(ucr-2.3) | WB-STRAIN:WBStrain00028976 | WormBase (WB) | WB | available | WB-STRAIN:NL1832, CGC_NL1832 | 2026-07-25 10:22:29 | 0 | |||
|
NL1834 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028977 | Caenorhabditis elegans | mut-9(pk734) | Mutator. | WBGene00003506(mut-9) | WBGene00003506(mut-9) | WB-STRAIN:WBStrain00028977 | WormBase (WB) | WB | available | WB-STRAIN:NL1834, CGC_NL1834 | 2026-07-25 10:22:30 | 0 | |||
|
NL1838 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00028978 | Caenorhabditis elegans | mut-14(pk738) | Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA. | WBGene00003507(mut-14) | WBGene00003507(mut-14) | WB-STRAIN:WBStrain00028978 | WormBase (WB) | WB | available | WB-STRAIN:NL1838, CGC_NL1838 | 2026-07-25 10:22:29 | 1 | |||
|
NL1888 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028979 | Caenorhabditis elegans | pash-1(pk2083)/+ I; pkIs2084. | pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain. | WBGene00011908(pash-1) | WBGene00011908(pash-1) | WB-STRAIN:WBStrain00028979 | WormBase (WB) | WB | available | WB-STRAIN:NL1888, CGC_NL1888 | 2026-07-25 10:22:29 | 0 | |||
|
NL1820 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028975 | Caenorhabditis elegans | mut-7(pk720) III. | Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator. | WBGene00003504(mut-7) | WBGene00003504(mut-7) | WB-STRAIN:WBStrain00028975 | WormBase (WB) | WB | available | WB-STRAIN:NL1820, CGC_NL1820 | 2026-07-25 10:22:29 | 0 | |||
|
NL737 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028929 | Caenorhabditis elegans | rde-3(r459) I; mek-1(pk97) X. | K08A8.1 Previously called kin-17(pk97). | WBGene00003185(mek-1) | WBGene00003185(mek-1) | WB-STRAIN:WBStrain00028929 | WormBase (WB) | WB | available | WB-STRAIN:NL737, CGC_NL737 | 2026-07-25 10:22:29 | 0 | |||
|
NL713 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028920 | Caenorhabditis elegans | rde-3(r459) I; sox-2(pk65). | K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.|"Made_by: M Vroomen" | WBGene00004949(sox-2) | WBGene00004949(sox-2) | WB-STRAIN:WBStrain00028920 | WormBase (WB) | WB | available | WB-STRAIN:NL713, CGC_NL713 | 2026-07-25 10:22:29 | 0 | |||
|
NL687 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028914 | Caenorhabditis elegans | dcr-1(pk1351)/+ III. | Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).|"Made_by: Fischer/Thijssen"|"Mutagen:UV/TMP"|"no longer available from the CGC." | WBGene00000939(dcr-1) | WBGene00000939(dcr-1) | WB-STRAIN:WBStrain00028914 | WormBase (WB) | WB | available | WB-STRAIN:NL687, CGC_NL687 | 2026-07-25 10:22:29 | 0 | |||
|
NL706 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028916 | Caenorhabditis elegans | rde-3(r459) cap-1(pk56::Tc1) I. | Made_by M. Vroomen|"Made_by: M. Vroomen" | WBGene00000292(cap-1) | WBGene00000292(cap-1) | WB-STRAIN:WBStrain00028916 | WormBase (WB) | WB | available | WB-STRAIN:NL706, CGC_NL706 | 2026-07-25 10:22:28 | 0 | |||
|
NL2330 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028998 | Caenorhabditis elegans | gpa-13(pk1270) V. | Made_by: | WBGene00001675(gpa-13) | WBGene00001675(gpa-13) | WB-STRAIN:WBStrain00028998 | WormBase (WB) | WB | available | PMID:10192394 | WB-STRAIN:NL2330, CGC_NL2330 | 2026-07-25 10:22:30 | 0 | ||
|
NL594 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028911 | Caenorhabditis elegans | gpa-12(pk322) X. | Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT . | WBGene00001674(gpa-12) | WBGene00001674(gpa-12) | WB-STRAIN:WBStrain00028911 | WormBase (WB) | WB | available | PMID:10192394 PMID:37527037 |
WB-STRAIN:NL594, CGC_NL594 | 2026-07-25 10:22:29 | 0 | ||
|
NL2331 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028999 | Caenorhabditis elegans | gpa-16(pk481)/bli-3(e767) I. | Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1. | WBGene00000253(bli-3)|WBGene00001678(gpa-16) | WBGene00000253(bli-3), WBGene00001678(gpa-16) | WB-STRAIN:WBStrain00028999 | WormBase (WB) | WB | available | WB-STRAIN:NL2331, CGC_NL2331 | 2026-07-25 10:22:29 | 0 | |||
|
NL2098 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00028994 | Caenorhabditis elegans | rrf-1(pk1417) I. | Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants."|"Mutagen:UV/TMP"|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"WBStrain mapped, WBPaper00060738 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061852 paper added based on AFP_Strain data." | WBGene00004508(rrf-1) | WBGene00004508(rrf-1) | WB-STRAIN:WBStrain00028994 | WormBase (WB) | WB | available | PMID:31717869 PMID:32943454 PMID:33289480 PMID:33319173 PMID:33594200 PMID:34449775 |
WB-STRAIN:NL2098, CGC_NL2098 | 2026-07-25 10:22:29 | 1 | ||
|
NL2511 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029001 | Caenorhabditis elegans | msh-6(pk2504) I. | Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6). | WBGene00003422(msh-6) | WBGene00003422(msh-6) | WB-STRAIN:WBStrain00029001 | WormBase (WB) | WB | available | WB-STRAIN:NL2511, CGC_NL2511 | 2026-07-25 10:22:30 | 0 | |||
|
NL1140 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028948 | Caenorhabditis elegans | dpy-20(e1282) IV; pkIs379. | pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached. | WBGene00001079(dpy-20) | WBGene00001079(dpy-20) | WB-STRAIN:WBStrain00028948 | WormBase (WB) | WB | available | PMID:10192394 | WB-STRAIN:NL1140, CGC_NL1140 | 2026-07-25 10:22:29 | 0 | ||
|
NL1142 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028949 | Caenorhabditis elegans | gpa-8(pk345) V. | Made_by: | WBGene00001670(gpa-8) | WBGene00001670(gpa-8) | WB-STRAIN:WBStrain00028949 | WormBase (WB) | WB | available | PMID:10192394 | WB-STRAIN:NL1142, CGC_NL1142 | 2026-07-25 10:22:29 | 0 | ||
|
NL1000 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028943 | Caenorhabditis elegans | cdh-3(pk87) III. | 2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.|"mut-2 background" | WBGene00000395(cdh-3) | WBGene00000395(cdh-3) | WB-STRAIN:WBStrain00028943 | WormBase (WB) | WB | available | PMID:9012534 | WB-STRAIN:NL1000, CGC_NL1000 | 2026-07-25 10:22:29 | 0 | ||
|
NL1100 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00028944 | Caenorhabditis elegans | rde-3(r459) I; prk-1(pk86::Tc1) III. | Insertion in CCTTCAGAAG TA TGTCATTTGG. | WBGene00004182(prk-1) | WBGene00004182(prk-1) | WB-STRAIN:WBStrain00028944 | WormBase (WB) | WB | available | WB-STRAIN:NL1100, CGC_NL1100 | 2026-07-25 10:22:29 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
