Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC2854 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037571 | Caenorhabditis elegans | H43I07.2(ok3654) V/nT1 [qIs51] (IV;V). | H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019275(rpac-40) | WBGene00019275(rpac-40) | WB-STRAIN:WBStrain00037571 | WormBase (WB) | WB | available | WB-STRAIN:VC2854, CGC_VC2854 | 2026-07-25 10:24:28 | 0 | |||
|
VC2859 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037574 | Caenorhabditis elegans | R09D1.13(gk3177) II. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3177) in R09D1.13, detectable by PCR using the following primers. External left primer: GCAATCGGGATGTTCTGAAT. External right primer: TGTTGGAGAAACTGTGCGAG. Internal left primer: ACAACGAAACATCGTCGGAT. Internal right primer: ATAAATATGGATGCCGCCAA. Internal WT amplicon: 2530 bp. Deletion size: approximately 1400 bp. Validation: gk3177 passed by CGH. Left deleted probe: AGGATCAATTTCGACTGGAATGTTGCCTATACTAATATTATCTCGAATGC. Right deleted probe: AATTAATATAACTAGATCCATTGCCATTTTCGGTTTGGCTGGAACATATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011169(R09D1.13) | WBGene00011169(R09D1.13) | WB-STRAIN:WBStrain00037574 | WormBase (WB) | WB | available | WB-STRAIN:VC2859, CGC_VC2859 | 2026-07-25 10:24:28 | 0 | |||
|
VC2860 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037575 | Caenorhabditis elegans | K09E4.1(gk1223) II. | K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010719(K09E4.1) | WBGene00010719(K09E4.1) | WB-STRAIN:WBStrain00037575 | WormBase (WB) | WB | available | WB-STRAIN:VC2860, CGC_VC2860 | 2026-07-25 10:24:25 | 0 | |||
|
VC2864 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037578 | Caenorhabditis elegans | Y75B8A.6(ok2294) III. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA." | WBGene00013543(Y75B8A.6) | WBGene00013543(Y75B8A.6) | WB-STRAIN:WBStrain00037578 | WormBase (WB) | WB | available | WB-STRAIN:VC2864, CGC_VC2864 | 2026-07-25 10:24:25 | 0 | |||
|
VC2873 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037579 | Caenorhabditis elegans | R03A10.3(ok3439) X. | R03A10.3. External left primer: TGCTGGAGTAGAGCGGGTAT. External right primer: GCAGAGAGCCTGAAAATTGC. Internal left primer: CCTTGTGGAAGGCCTTGTT. Internal right primer: GCACAGCCCTGATTCCTACT. Internal WT amplicon: 1181 bp. Deletion size: 621 bp. Deletion left flank: CAGTTTTTTTCCGTTTCACTTACCACATCG. Deletion right flank: CCCAACTACAGAATGATGCGAATCGTAGAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010983(mocs-1) | WBGene00010983(mocs-1) | WB-STRAIN:WBStrain00037579 | WormBase (WB) | WB | available | WB-STRAIN:VC2873, CGC_VC2873 | 2026-07-25 10:24:25 | 0 | |||
|
VC2876 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00037580 | Caenorhabditis elegans | egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II. | F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00009701(egg-3) | WBGene00001072(dpy-10), WBGene00009701(egg-3) | WB-STRAIN:WBStrain00037580 | WormBase (WB) | WB | available | WB-STRAIN:VC2876, CGC_VC2876 | 2026-07-25 10:24:28 | 1 | |||
|
VC2896 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037583 | Caenorhabditis elegans | F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I. | F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006829(unc-101)|WBGene00009305(metl-17) | WBGene00006829(unc-101), WBGene00009305(metl-17) | WB-STRAIN:WBStrain00037583 | WormBase (WB) | WB | available | WB-STRAIN:VC2896, CGC_VC2896 | 2026-07-25 10:24:28 | 0 | |||
|
VC2897 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037584 | Caenorhabditis elegans | gpi-1(ok3599)/hIn1 [unc-101(sy241)] I. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA." | WBGene00006829(unc-101)|WBGene00013597(gpi-1) | WBGene00006829(unc-101), WBGene00013597(gpi-1) | WB-STRAIN:WBStrain00037584 | WormBase (WB) | WB | available | WB-STRAIN:VC2897, CGC_VC2897 | 2026-07-25 10:24:25 | 0 | |||
|
VC2795 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037547 | Caenorhabditis elegans | F36H12.9(gk1123) IV. | F36H12.9. Identified by PCR, validated by CGH. External left primer: TGTTGTGGAAGTGCAAGAGG. External right primer: CGTATCGGTTAGTCGGCATT. Internal left primer: GCCTCAGCGATATGGAGAAG. Internal right primer: AGAAATCCTTTGTCGATGCG. Internal WT amplicon: 1008 bp. Deletion size: 761 bp. Deletion left flank: TACTCCGCCTCAGCGATATGGAGAAGTTTG. Deletion right flank: ATATATTGTTTTCAGTACTTGGATACTCTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00018123(F36H12.9) | WBGene00018123(F36H12.9) | WB-STRAIN:WBStrain00037547 | WormBase (WB) | WB | available | WB-STRAIN:VC2795, CGC_VC2795 | 2026-07-25 10:24:28 | 0 | |||
|
VC2793 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037546 | Caenorhabditis elegans | T10B5.2(gk1153) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T10B5.2. External left primer: CTCGGTTTGTACCATGGCTT. External right primer: AATTTTGCGTATTGCGAACC. Internal left primer: GATCTTCCTCATCGTGCCAT. Internal right primer: AGGACATCCGGGAGAGACTT. Internal WT amplicon: 2414 bp. Deletion size: 851 bp. Deletion left flank: AAATGATAGAAGGTCTGCTGGTACTGTGTT. Deletion right flank: GTCCCTCCATCCATCTTCGATATTTTTGGT. Insertion Sequence: TTGTTTGTGT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020388(T10B5.2) | WBGene00020388(T10B5.2) | WB-STRAIN:WBStrain00037546 | WormBase (WB) | WB | available | WB-STRAIN:VC2793, CGC_VC2793 | 2026-07-25 10:24:25 | 0 | |||
|
VC2802 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037550 | Caenorhabditis elegans | K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00005724(srv-13)|WBGene00010772(K11D9.3)|WBGene00011327(hlh-34) | WBGene00005724(srv-13), WBGene00010772(K11D9.3), WBGene00011327(hlh-34) | WB-STRAIN:WBStrain00037550 | WormBase (WB) | WB | available | WB-STRAIN:VC2802, CGC_VC2802 | 2026-07-25 10:24:28 | 0 | |||
|
VC2819 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037554 | Caenorhabditis elegans | F15D4.3(ok3521)/mT1 II; +/mT1 [dpy-10(e128)] III. | F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00008860(romo-1) | WBGene00001072(dpy-10), WBGene00008860(romo-1) | WB-STRAIN:WBStrain00037554 | WormBase (WB) | WB | available | WB-STRAIN:VC2819, CGC_VC2819 | 2026-07-25 10:24:25 | 0 | |||
|
VC2805 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037552 | Caenorhabditis elegans | Y111B2A.1(gk1164) III. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT." | WBGene00013727(Y111B2A.1) | WBGene00013727(Y111B2A.1) | WB-STRAIN:WBStrain00037552 | WormBase (WB) | WB | available | WB-STRAIN:VC2805, CGC_VC2805 | 2026-07-25 10:24:25 | 0 | |||
|
VC2826 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037558 | Caenorhabditis elegans | C09H10.7(ok2466)/mIn1 [mIs14 dpy-10(e128)] II. | C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00003133(apc-1) | WBGene00001072(dpy-10), WBGene00003133(apc-1) | WB-STRAIN:WBStrain00037558 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC2826, CGC_VC2826 | 2026-07-25 10:24:25 | 0 | ||
|
VC2828 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037559 | Caenorhabditis elegans | Y79H2A.3(gk1219) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT." | WBGene00000254(bli-4)|WBGene00013580(Y79H2A.3) | WBGene00000254(bli-4), WBGene00013580(Y79H2A.3) | WB-STRAIN:WBStrain00037559 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC2828, CGC_VC2828 | 2026-07-25 10:24:28 | 0 | ||
|
VC2824 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037556 | Caenorhabditis elegans | H28O16.1(ok2203) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00010419(atp-1) | WBGene00000254(bli-4), WBGene00010419(atp-1) | WB-STRAIN:WBStrain00037556 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:VC2824, CGC_VC2824 | 2026-07-25 10:24:28 | 0 | ||
|
VC2837 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037562 | Caenorhabditis elegans | +/mT1 II; ugtp-1(ok3492)/mT1 [dpy-10(e128)] III. | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK370.7. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3492 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAATCCGTTTCTGTCGTCT. External right primer: ATGATGCTCTTTCTCGGTCG. Internal left primer: TTGGCGAGAATTTATGAGCC. Internal right primer: TCGATGGATGGCAATTACAC. Internal WT amplicon: 1168 bp. Deletion size: 505 bp. Deletion left flank: TTAAGTTTATACAATTAAAGCTTTTGGCTA. Deletion right flank: TTTTTCAAACGATTTGAAAAAAAAACCCTA." | WBGene00001072(dpy-10)|WBGene00022721(ugtp-1) | WBGene00001072(dpy-10), WBGene00022721(ugtp-1) | WB-STRAIN:WBStrain00037562 | WormBase (WB) | WB | available | WB-STRAIN:VC2837, CGC_VC2837 | 2026-07-25 10:24:28 | 0 | |||
|
VC2835 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037560 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; unc-18(ok3477)/szT1 X. | F27D9.1. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3477 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGTGGTCTGACATCGAACCT. External right primer: GGGGCTCTGAAAATGAAACA. Internal left primer: GAATTGCTGAACAAATCGCA. Internal right primer: GGGTTGAAATGAGCAATCATC. Internal WT amplicon: 1331 bp. Deletion size: 371 bp. Deletion left flank: TTACTCTTCAAGCAATGTGCTACGACCTTT. Deletion right flank: CAGTATCAACAAGGAGTTGACAAGTTGTGT. Insertion Sequence: AGACCTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003056(lon-2)|WBGene00006757(unc-18) | WBGene00003056(lon-2), WBGene00006757(unc-18) | WB-STRAIN:WBStrain00037560 | WormBase (WB) | WB | available | WB-STRAIN:VC2835, CGC_VC2835 | 2026-07-25 10:24:25 | 0 | |||
|
VC2760 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037529 | Caenorhabditis elegans | ZK524.4(gk1212) I. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK524.4. Identified by PCR, validated by CGH. External left primer: GAAGTACCTGCTGCTTTGCC. External right primer: TATATGCAACTGCGCTCCAG. Internal left primer: GCTATTGCTCCAGCAACCAT. Internal right primer: TATGTCAAATGCGCCTGAAA. Internal WT amplicon: 1629 bp. Deletion size: 823 bp. Deletion left flank: AGCATATACAAAATAACACCTAATGACCAT. Deletion right flank: CCCTGATGTGCAACGATGATTTTCGGCGGA. Insertion Sequence: GTTCAGCATGGTCAAATATAC." | WBGene00013994(ZK524.4) | WBGene00013994(ZK524.4) | WB-STRAIN:WBStrain00037529 | WormBase (WB) | WB | available | WB-STRAIN:VC2760, CGC_VC2760 | 2026-07-25 10:24:28 | 0 | |||
|
VC2755 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00037527 | Caenorhabditis elegans | F01D4.3(gk1221) IV. | F01D4.3. Identified by PCR, validated by CGH. External left primer: TCCTCCAATGGTGGTTGACT. External right primer: CCGGATGGAGACAAAAAGAA. Internal left primer: ATCACTTGCTCCGGTTTCAC. Internal right primer: CCAATTCAGTCTGATGGCAA. Internal WT amplicon: 1179 bp. Deletion size: 505 bp. Deletion left flank: TTTCTCCGCAATCGGTACAACAGTTCCAGT. Deletion right flank: CGCTATTCCAAATACATTTTTCTTTTCAGT. Insertion Sequence: TT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008487(F01D4.3) | WBGene00008487(F01D4.3) | WB-STRAIN:WBStrain00037527 | WormBase (WB) | WB | available | WB-STRAIN:VC2755, CGC_VC2755 | 2026-07-25 10:24:25 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
