Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 11 showing 201 ~ 220 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00028702

http://www.wormbase.org/db/get?name=WBStrain00028702

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00005023(sqv-5)
Genomic Alteration: WBGene00005023(sqv-5)
Availability: available
References:
Synonyms: sqv-5(k175) I.
Alternate IDs: WB-STRAIN:NF199, CGC_NF199
Notes: DTC migration defect.

Proper citation: RRID:WB-STRAIN:WBStrain00028702 Copy   

    • RRID:WB-STRAIN:WBStrain00028704

http://www.wormbase.org/db/get?name=WBStrain00028704

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003254(mig-23)
Genomic Alteration: WBGene00003254(mig-23)
Availability: available
References:
Synonyms: mig-23(k180) X.
Alternate IDs: WB-STRAIN:NF317, CGC_NF317
Notes: Distal tip cell migration defective. Tc1 insertion mutant. Spontaneous mutant with ventral white patch phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00028704 Copy   

    • RRID:WB-STRAIN:WBStrain00028787

http://www.wormbase.org/db/get?name=WBStrain00028787

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC200
Notes: Isotype: NIC199|"Reference_strain: False"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028787 Copy   

    • RRID:WB-STRAIN:WBStrain00028781

http://www.wormbase.org/db/get?name=WBStrain00028781

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC166
Notes: Isotype: NIC166|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028781 Copy   

    • RRID:WB-STRAIN:WBStrain00028782

http://www.wormbase.org/db/get?name=WBStrain00028782

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC195
Notes: Isotype: NIC195|"Reference_strain: True"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028782 Copy   

    • RRID:WB-STRAIN:WBStrain00028780

http://www.wormbase.org/db/get?name=WBStrain00028780

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:NIC4
Notes: Isotype: NIC3|"Reference_strain: False"|"Sequenced: True"

Proper citation: RRID:WB-STRAIN:WBStrain00028780 Copy   

    • RRID:WB-STRAIN:WBStrain00028774

http://www.wormbase.org/db/get?name=WBStrain00028774

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001184(egl-15)|WBGene00003056(lon-2)
Genomic Alteration: WBGene00001184(egl-15), WBGene00003056(lon-2)
Availability: available
References:
Synonyms: +/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X.
Alternate IDs: WB-STRAIN:NH2693, CGC_NH2693
Notes: Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).|"Made_by: R. Burdine"

Proper citation: RRID:WB-STRAIN:WBStrain00028774 Copy   

    • RRID:WB-STRAIN:WBStrain00028775

http://www.wormbase.org/db/get?name=WBStrain00028775

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001184(egl-15)|WBGene00003559(ncl-1)
Genomic Alteration: WBGene00001184(egl-15), WBGene00003559(ncl-1)
Availability: available
References:
Synonyms: ncl-1(e1865) III; egl-15(n1456) X; ayEx86.
Alternate IDs: WB-STRAIN:NH3027, CGC_NH3027
Notes: ayEx86 [col-19::GFP + egl-15(+) (NH#112) + ncl-1(+)(c33c3)]. Maintain by picking non-Egl. Referene: Lo TW, et al. Dev Biol. 2008 Jun 15;318(2):268-75.|"Made_by: Catherine Branda"

Proper citation: RRID:WB-STRAIN:WBStrain00028775 Copy   

    • RRID:WB-STRAIN:WBStrain00028776

http://www.wormbase.org/db/get?name=WBStrain00028776

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00018788(shc-1)
Genomic Alteration: WBGene00018788(shc-1)
Availability: available
References:
Synonyms: F54A5.3a(ok198) I.
Alternate IDs: WB-STRAIN:NH3119, CGC_NH3119
Notes: Mutagen:UV/TMP|"No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3."

Proper citation: RRID:WB-STRAIN:WBStrain00028776 Copy   

    • RRID:WB-STRAIN:WBStrain00028723

http://www.wormbase.org/db/get?name=WBStrain00028723

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: vlcEx800.
Alternate IDs: WB-STRAIN:NFB1352, CGC_NFB1352
Notes: Made_by: Carla Lloret & Carlos Mora|"vlcEx800 [pan-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pan-1 enhancer sequence (-1050, -148) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028723 Copy   

    • RRID:WB-STRAIN:WBStrain00028724

http://www.wormbase.org/db/get?name=WBStrain00028724

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020368(ast-1)
Genomic Alteration: WBGene00020368(ast-1)
Availability: available
References:
Synonyms: ast-1(vlc19[ast-1::GFP]) II.
Alternate IDs: WB-STRAIN:NFB1369, CGC_NFB1369
Notes: Made_by: Carla Lloret & Carlos Mora|"vlc19[ast-1::GFP] II. Superficially wild-type. Endogenous ast-1 locus tagged with GFP using Cas9-triggered homologous recombination. GFP was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028724 Copy   

    • RRID:WB-STRAIN:WBStrain00028725

http://www.wormbase.org/db/get?name=WBStrain00028725

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001950(hlh-3)
Genomic Alteration: WBGene00001950(hlh-3)
Availability: available
References:
Synonyms: hlh-3(vlc28[hlh-3::mNeonGreen]) II.
Alternate IDs: WB-STRAIN:NFB1692, CGC_NFB1692
Notes: Made_by: Carla Lloret & Carlos Mora|"vlc28[hlh-3::mNeonGreen] II. Superficially wild-type. Endogenous hlh-3 locus tagged with mNeonGreen using Cas9-triggered homologous recombination. mNeonGreen was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028725 Copy   

    • RRID:WB-STRAIN:WBStrain00028726

http://www.wormbase.org/db/get?name=WBStrain00028726

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: vlcEx1091.
Alternate IDs: WB-STRAIN:NFB1895, CGC_NFB1895
Notes: Made_by: Carla Lloret & Carlos Mora|"vlcEx1091 [snt-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains snt-1 enhancer sequence (+993, +2170) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028726 Copy   

    • RRID:WB-STRAIN:WBStrain00028720

http://www.wormbase.org/db/get?name=WBStrain00028720

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: vlcEx683.
Alternate IDs: WB-STRAIN:NFB1181, CGC_NFB1181
Notes: Made_by: Carla Lloret & Carlos Mora|"vlcEx683 [mgl-2p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains mgl-2 enhancer sequence (-4183, -3367) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028720 Copy   

    • RRID:WB-STRAIN:WBStrain00028717

http://www.wormbase.org/db/get?name=WBStrain00028717

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: vlcEx653.
Alternate IDs: WB-STRAIN:NFB1151, CGC_NFB1151
Notes: Made_by: Carla Lloret & Carlos Mora|"vlcEx653 [pde-3p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pde-3 enhancer sequence (-2539, -1599) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028717 Copy   

    • RRID:WB-STRAIN:WBStrain00028718

http://www.wormbase.org/db/get?name=WBStrain00028718

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: vlcEx666.
Alternate IDs: WB-STRAIN:NFB1164, CGC_NFB1164
Notes: Made_by: Carla Lloret & Carlos Mora|"vlcEx666 [klp-7p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains klp-7 enhancer sequence (+1434, +2287) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785."

Proper citation: RRID:WB-STRAIN:WBStrain00028718 Copy   

    • RRID:WB-STRAIN:WBStrain00028710

http://www.wormbase.org/db/get?name=WBStrain00028710

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00022121(cogc-3)
Genomic Alteration: WBGene00022121(cogc-3)
Availability: available
References:
Synonyms: cogc-3(k181) I.
Alternate IDs: WB-STRAIN:NF1684, CGC_NF1684
Notes: Distal tip cell migration defective. Growth delay. Protruding vulva.

Proper citation: RRID:WB-STRAIN:WBStrain00028710 Copy   

    • RRID:WB-STRAIN:WBStrain00028870

http://www.wormbase.org/db/get?name=WBStrain00028870

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed4) III; qyEx114.
Alternate IDs: WB-STRAIN:NK773, CGC_NK773
Notes: qyEx114 [C28C12.10::GFP + unc-119(+)]. Maintain by picking non-Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00028870 Copy   

    • RRID:WB-STRAIN:WBStrain00028871

http://www.wormbase.org/db/get?name=WBStrain00028871

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed4) III; qyEx116.
Alternate IDs: WB-STRAIN:NK774, CGC_NK774
Notes: qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc.|"Supplementary_genotype qyEx116 [pcgef-1b::GFP + unc-119(+)]"

Proper citation: RRID:WB-STRAIN:WBStrain00028871 Copy   

    • RRID:WB-STRAIN:WBStrain00028872

http://www.wormbase.org/db/get?name=WBStrain00028872

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed4) III; qyEx117.
Alternate IDs: WB-STRAIN:NK775, CGC_NK775
Notes: qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc.|"Supplementary_genotype qyEx117 [pcgef-1a,c::GFP + unc-119(+)]"

Proper citation: RRID:WB-STRAIN:WBStrain00028872 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

NIDM Terminology

Recent News Entries

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch