Plasmids   Select Another Resource Report Type

http://www.addgene.org/21875

Species:
Genetic Insert: CSH100 bacterial Strain
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: F’ lac proA+proB+(lacIq lacPL8)/ara- ∆(gpt-lac)5 This strain will be shipped as bacteria in an LB stab. Upon receipt, requesting scientists should restreak the strain on an M9 minimal plate. After restreaking on M9 to confirm the presence of the F', scientists can grow the strain in liquid LB. M9 minimal medium agar plates: To prepare 500 ml, autoclave 439 ml H2O with 7.5 g Bacto-agar and a stir bar. When agar has cooled to approximately 65°C, add 50 ml 10X M9 salts, 1 ml 1 M MgSO4, 10 ml 20% (w/v) glucose and 0.5 ml 100mM CaCl2 and then pour plates. Plates can be stored indefinitely at 4°C in sealed plastic bags. (Alternatively, M9 plates can be purchased from Teknonva: https://www.teknova.com/content/teknova/us/en/products/product-page.html/m1260.html).

Proper citation: RRID:Addgene_21875 Copy   

•   Source: Addgene

http://www.addgene.org/34929

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
References:
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.

Proper citation: RRID:Addgene_34929 Copy   

•   Source: Addgene

http://www.addgene.org/37853

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_37853 Copy   

•   Source: Addgene

http://www.addgene.org/37854

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:E. coli bacterial strain; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_37854 Copy   

•   Source: Addgene

http://www.addgene.org/176581

Species:
Genetic Insert: This is a strain.
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176581 Copy   

•   Source: Addgene

http://www.addgene.org/11794

Species:
Genetic Insert: JS200
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: For use with pEP PolI (addgene #11722) and pWT PolI (addgene #11721). This strain contains a temp sens mutation in PolI.

Proper citation: RRID:Addgene_11794 Copy   

•   Source: Addgene

http://www.addgene.org/118727

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at HK022 attB: pOSIP-KH-RBS2-dCas9

Proper citation: RRID:Addgene_118727 Copy   

•   Source: Addgene

http://www.addgene.org/102263

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102263 Copy   

•   Source: Addgene

http://www.addgene.org/102265

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102265 Copy   

•   Source: Addgene

http://www.addgene.org/102262

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102262 Copy   

•   Source: Addgene

http://www.addgene.org/102256

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102256 Copy   

•   Source: Addgene

http://www.addgene.org/102257

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102257 Copy   

•   Source: Addgene

http://www.addgene.org/102266

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102266 Copy   

•   Source: Addgene

http://www.addgene.org/102267

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102267 Copy   

•   Source: Addgene

http://www.addgene.org/102799

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB Precursor strain = RF14 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser+++++ +++++ RF15 has knockouts in aspC, tyrB, trpA, trpB, glyA and serB genes and requires the presence of L-Asp, L-Tyr, L-Trp, L-Gly plus L-Ser for growth in M63 minimal medium, but it does NOT grow in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys (either in the presence or absence of L-Ala) (i.e., L-Cys inhibits the growth of RF15) Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102799 Copy   

•   Source: Addgene

http://www.addgene.org/102803

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE avtA yfbQ(alaA) yfdZ(alaC) Precursor strain = RF18 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu, Val#### #### RF21 has knockouts in the four general transaminase genes of E. coli (aspC, tyrB, ilvE, and avtA) and is found to require the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium. Although RF21 strain has further knockouts in yfbQ (alaA) and yfdZ (alaC) genes, it is NOT an L-Ala auxotroph, either (requiring the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium, like RF18). Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102803 Copy   

•   Source: Addgene

http://www.addgene.org/102802

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE avtA Precursor strain = RF17 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu, Val#### ####RF18 has knockouts in the four general transaminase genes of E. coli (aspC, tyrB, ilvE, and avtA) and is found to require the presence of L-Asp, L-Tyr, L-Phe, L-Ile, L-Leu plus L-Val for slow growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102802 Copy   

•   Source: Addgene

http://www.addgene.org/119737

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files.

Proper citation: RRID:Addgene_119737 Copy   

•   Source: Addgene

http://www.addgene.org/49761

Species:
Genetic Insert: Relevant genotype: recA1, endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_49761 Copy   

•   Source: Addgene

http://www.addgene.org/49759

Species: E.coli
Genetic Insert: Relevant genotype: endA1, gyrA96, thi, hsdR17, supE44, relA1, λ-, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_49759 Copy   

•   Source: Addgene