SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 790 results
Snippet view Table view Download 790 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_25759

http://www.addgene.org/25759

Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA

Proper citation: RRID:Addgene_25759 Copy   


  • RRID:Addgene_25755

    This resource has 10+ mentions.

http://www.addgene.org/25755

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT

Proper citation: RRID:Addgene_25755 Copy   


  • RRID:Addgene_25757

http://www.addgene.org/25757

Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site.

Proper citation: RRID:Addgene_25757 Copy   


  • RRID:Addgene_25752

    This resource has 1+ mentions.

http://www.addgene.org/25752

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT

Proper citation: RRID:Addgene_25752 Copy   


  • RRID:Addgene_25751

    This resource has 1+ mentions.

http://www.addgene.org/25751

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE

Proper citation: RRID:Addgene_25751 Copy   


  • RRID:Addgene_25767

    This resource has 1+ mentions.

http://www.addgene.org/25767

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven GFP

Proper citation: RRID:Addgene_25767 Copy   


  • RRID:Addgene_25763

http://www.addgene.org/25763

Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.

Proper citation: RRID:Addgene_25763 Copy   


  • RRID:Addgene_25762

http://www.addgene.org/25762

Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site.

Proper citation: RRID:Addgene_25762 Copy   


  • RRID:Addgene_25765

http://www.addgene.org/25765

Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT

Proper citation: RRID:Addgene_25765 Copy   


  • RRID:Addgene_25764

http://www.addgene.org/25764

Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site.

Proper citation: RRID:Addgene_25764 Copy   


  • RRID:Addgene_25760

http://www.addgene.org/25760

Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT

Proper citation: RRID:Addgene_25760 Copy   


  • RRID:Addgene_25749

http://www.addgene.org/25749

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE

Proper citation: RRID:Addgene_25749 Copy   


  • RRID:Addgene_25748

    This resource has 10+ mentions.

http://www.addgene.org/25748

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE

Proper citation: RRID:Addgene_25748 Copy   


http://www.addgene.org/100590

Genetic Insert: Lifeact-Citrine
Vector Backbone Description: Vector Backbone:pDONR207; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27703856

Proper citation: RRID:Addgene_100590 Copy   


  • RRID:Addgene_100591

http://www.addgene.org/100591

Species: Mus musculus
Genetic Insert: mTalin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Repoter plasmid; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27703856

Proper citation: RRID:Addgene_100591 Copy   


  • RRID:Addgene_100600

http://www.addgene.org/100600

Species: Marchantia polymorpha
Genetic Insert: MpPHOT
Vector Backbone Description: Vector Backbone:pDONR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27027881

Proper citation: RRID:Addgene_100600 Copy   


  • RRID:Addgene_101652

    This resource has 1+ mentions.

http://www.addgene.org/101652

Species: Synthetic
Genetic Insert: LRP6 Signal peptide, MCS linker, Twin-Strep tag
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29143175

Proper citation: RRID:Addgene_101652 Copy   


  • RRID:Addgene_101653

    This resource has 1+ mentions.

http://www.addgene.org/101653

Species: Synthetic
Genetic Insert: LRP6 Signal peptide, MCS linker, 3xFLAG tag
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29143175

Proper citation: RRID:Addgene_101653 Copy   


  • RRID:Addgene_101654

    This resource has 1+ mentions.

http://www.addgene.org/101654

Species: Synthetic
Genetic Insert: LRP6 Signal peptide, KpnI linker, 3xFLAG tag
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29143175

Proper citation: RRID:Addgene_101654 Copy   


  • RRID:Addgene_101831

    This resource has 1+ mentions.

http://www.addgene.org/101831

Species: S. elongatus PCC7942
Genetic Insert: RpaA D53A with p0050 promoter (+ gentamicin resistance casette)
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pBR322; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:28430105

Proper citation: RRID:Addgene_101831 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X