SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

790 Results - per page

Show More Columns | Download 790 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pEN_hU6miR-Gb2-K
 
Resource Report
Resource Website 		RRID:Addgene_25759 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TTmcs
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_25755 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 19
pEN_hU6miR-G12-E
 
Resource Report
Resource Website 		RRID:Addgene_25757 G alpha 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site. Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TTmiRc2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25752 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 6
pEN_Tmcs
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25751 Gentamicin PMID:16945906 TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 6
pEN_TRE_GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25767 Gentamicin PMID:16945906 Entry vector with TRE-driven GFP Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 1
pEN_TmiR_G13-L_G12-E
 
Resource Report
Resource Website 		RRID:Addgene_25763 G alpha 13 and 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TmiR_G13-L
 
Resource Report
Resource Website 		RRID:Addgene_25762 G alpha 13 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TGmiR_Luc-A
 
Resource Report
Resource Website 		RRID:Addgene_25765 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TmiR_Gb2-K
 
Resource Report
Resource Website 		RRID:Addgene_25764 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TmiR_Luc-A
 
Resource Report
Resource Website 		RRID:Addgene_25760 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TGmiRc3
 
Resource Report
Resource Website 		RRID:Addgene_25749 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 0
pEN_TmiRc3
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_25748 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:16:19 12
pDONR207-Lifeact-Citrine
 
Resource Report
Resource Website 		RRID:Addgene_100590 Lifeact-Citrine Gentamicin PMID:27703856 Vector Backbone:pDONR207; Vector Types:; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:03:55 0
pDONR207-mTalin
 
Resource Report
Resource Website 		RRID:Addgene_100591 mTalin Mus musculus Gentamicin PMID:27703856 Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Repoter plasmid; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:03:55 0
pDONR207-MpPHOT
 
Resource Report
Resource Website 		RRID:Addgene_100600 MpPHOT Marchantia polymorpha Gentamicin PMID:27027881 Vector Backbone:pDONR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:03:56 0
pGS_C_Strep
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101652 LRP6 Signal peptide, MCS linker, Twin-Strep tag Synthetic Gentamicin PMID:29143175 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:04:03 1
pGS_C_3xFLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101653 LRP6 Signal peptide, MCS linker, 3xFLAG tag Synthetic Gentamicin PMID:29143175 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:04:03 1
pGS_N_3xFLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101654 LRP6 Signal peptide, KpnI linker, 3xFLAG tag Synthetic Gentamicin PMID:29143175 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Addgene 2026-09-19 02:04:03 1
P0050::rpaAD53A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101831 RpaA D53A with p0050 promoter (+ gentamicin resistance casette) S. elongatus PCC7942 Gentamicin PMID:28430105 Backbone Size:4400; Vector Backbone:pBR322; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin D53 mutated to A Addgene 2026-09-19 02:04:04 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

NIDM Terminology

Recent News Entries

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch