Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 178,387 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_100805

    This resource has 1+ mentions.

http://www.addgene.org/100805

Species: Rattus norvegicus
Genetic Insert: SaBE4
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28875174

Proper citation: RRID:Addgene_100805 Copy   


  • RRID:Addgene_100806

    This resource has 10+ mentions.

http://www.addgene.org/100806

Species: Rattus norvegicus
Genetic Insert: BE4-Gam
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28875174

Proper citation: RRID:Addgene_100806 Copy   


  • RRID:Addgene_100807

http://www.addgene.org/100807

Species: Rattus norvegicus
Genetic Insert: BE3-Gam
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28875174

Proper citation: RRID:Addgene_100807 Copy   


  • RRID:Addgene_100808

    This resource has 1+ mentions.

http://www.addgene.org/100808

Species: rabies virus
Genetic Insert: rabies virus CVS N2c strain phosphoprotein gene
Vector Backbone Description: Backbone Marker:Connie Cepko; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100808 Copy   


  • RRID:Addgene_100801

    This resource has 1+ mentions.

http://www.addgene.org/100801

Species: rabies virus
Genetic Insert: rabies virus CVS N2c strain nucleoprotein gene
Vector Backbone Description: Backbone Marker:Connie Cepko; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100801 Copy   


  • RRID:Addgene_100802

    This resource has 1+ mentions.

http://www.addgene.org/100802

Species: Rattus norvegicus
Genetic Insert: BE
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28875174

Proper citation: RRID:Addgene_100802 Copy   


  • RRID:Addgene_100804

    This resource has 1+ mentions.

http://www.addgene.org/100804

Species: Synthetic
Genetic Insert: CDA1-BE3
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28875174

Proper citation: RRID:Addgene_100804 Copy   


  • RRID:Addgene_100765

    This resource has 1+ mentions.

http://www.addgene.org/100765

Species: Synthetic
Genetic Insert: Lenti-Mito-Car-GECO
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7067; Vector Backbone:pLenti-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511336
Comments: sub-cloned from Addgene CMV-mito-CAR-GECO1 #46022

Proper citation: RRID:Addgene_100765 Copy   


  • RRID:Addgene_100800

http://www.addgene.org/100800

Species: Other
Genetic Insert: fusion protein of EnvA extracellular and transmembrane domain with rabies virus glycoprotein intracellular domain
Vector Backbone Description: Backbone Marker:Connie Cepko; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100800 Copy   


  • RRID:Addgene_100760

http://www.addgene.org/100760

Species: Homo sapiens
Genetic Insert: GST-Nix-S212A
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Use E. coli LB21 for expression

Proper citation: RRID:Addgene_100760 Copy   


  • RRID:Addgene_100761

http://www.addgene.org/100761

Species: Homo sapiens
Genetic Insert: GST-Nix-S212D
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4900; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Use E. coli LB21 for expression

Proper citation: RRID:Addgene_100761 Copy   


  • RRID:Addgene_100762

http://www.addgene.org/100762

Species: Homo sapiens
Genetic Insert: BCL2 interacting protein 3 like
Vector Backbone Description: Backbone Size:6078; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100762 Copy   


  • RRID:Addgene_100763

http://www.addgene.org/100763

Species: Homo sapiens
Genetic Insert: BCL2 interacting protein 3 like
Vector Backbone Description: Backbone Size:6078; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100763 Copy   


  • RRID:Addgene_100779

http://www.addgene.org/100779

Species: Homo sapiens
Genetic Insert: CPI-17-T38A-NES
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100779 Copy   


  • RRID:Addgene_100814

http://www.addgene.org/100814

Species: Homo sapiens
Genetic Insert: p110 CUX1 (amino acids 878-1505)
Vector Backbone Description: Vector Backbone:pXJ42; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18347061

Proper citation: RRID:Addgene_100814 Copy   


  • RRID:Addgene_100815

http://www.addgene.org/100815

Genetic Insert: TGCTGTTGACAGTGAGCGTCTTCTCGTTTGAAACTTTGAATAGTGAAGCCA
Vector Backbone Description: Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24618719

Proper citation: RRID:Addgene_100815 Copy   


  • RRID:Addgene_100770

    This resource has 1+ mentions.

http://www.addgene.org/100770

Species: Homo sapiens
Genetic Insert: Lenti-sh-Nix
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33044904

Proper citation: RRID:Addgene_100770 Copy   


  • RRID:Addgene_100776

http://www.addgene.org/100776

Species: Homo sapiens
Genetic Insert: CPI-17-NLS
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100776 Copy   


  • RRID:Addgene_100778

http://www.addgene.org/100778

Species: Homo sapiens
Genetic Insert: CPI-17-T38E-NLS
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100778 Copy   


  • RRID:Addgene_100811

    This resource has 1+ mentions.

http://www.addgene.org/100811

Species: rabies virus
Genetic Insert: rabies virus CVS N2c strain glycoprotein gene
Vector Backbone Description: Backbone Marker:Connie Cepko; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_100811 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X