Plasmids   Select Another Resource Report Type

http://www.addgene.org/214747

Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function.

Proper citation: RRID:Addgene_214747 Copy   

•   Source: Addgene
  

http://www.addgene.org/214748

Species: other
Genetic Insert: BBa_J23119-RBS(22821)-mcherry
Vector Backbone Description: Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None
Defining Citation: PMID:38086386
Comments: Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function.

Proper citation: RRID:Addgene_214748 Copy   

•   Source: Addgene
  

http://www.addgene.org/102264

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102264 Copy   

•   Source: Addgene
  

http://www.addgene.org/102260

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102260 Copy   

•   Source: Addgene
  

http://www.addgene.org/102261

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102261 Copy   

•   Source: Addgene
  

http://www.addgene.org/102258

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102258 Copy   

•   Source: Addgene
  

http://www.addgene.org/102259

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102259 Copy   

•   Source: Addgene
  

http://www.addgene.org/102268

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102268 Copy   

•   Source: Addgene
  

http://www.addgene.org/102269

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔlamB ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102269 Copy   

•   Source: Addgene
  

http://www.addgene.org/102804

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33289521
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= thrC ilvA Precursor strain = RF2 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Thr, Ile EH1 requires L-Thr and L-Ile for growth in M63 minimal medium Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102804 Copy   

•   Source: Addgene
  

http://www.addgene.org/102800

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33289521
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB cysE Precursor strain = RF15 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser, Cys++++++, Ala++++++ ++++++ RF16 grows slowly in the LB medium, does NOT grow in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys. RF16 (but not RF15) grows very slowly in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser, L-Cys plus L-Ala. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102800 Copy   

•   Source: Addgene
  

http://www.addgene.org/102801

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33289521
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102801 Copy   

•   Source: Addgene
  

http://www.addgene.org/237425

Species: n/a
Genetic Insert: none
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40595632
Comments: Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C To verify the gyrA gene using the following primers: gyrA462-F: cccgtcgtactattttcgaac gyrA462-R: cagcagtcggtcgataaagtc The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference. Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above. Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.

Proper citation: RRID:Addgene_237425 Copy   

•   Source: Addgene
  

http://www.addgene.org/248174

Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir4150-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.

Proper citation: RRID:Addgene_248174 Copy   

•   Source: Addgene
  

http://www.addgene.org/248176

Species: N/A
Vector Backbone Description: Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:41529903
Comments: K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, J23117-B0033-PirWT-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint.

Proper citation: RRID:Addgene_248176 Copy   

•   Source: Addgene
  

http://www.addgene.org/229546

Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt trpR::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of trpR knock-out: Fwd - prEP184, gtatcactctctgctttattaccggcaa Rev - prEP186, gcggcaataatggtgtcgat Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.

Proper citation: RRID:Addgene_229546 Copy   

•   Source: Addgene
  

http://www.addgene.org/34928

Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.

Proper citation: RRID:Addgene_34928 Copy   

•   Source: Addgene
  

http://www.addgene.org/52055

Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22982858
Comments: We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-­‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics). See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2.

Proper citation: RRID:Addgene_52055 Copy   

•   Source: Addgene
  

http://www.addgene.org/52702

Genetic Insert: Oplac2 (37)-KI strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KIlac with those of OpLac2.

Proper citation: RRID:Addgene_52702 Copy   

•   Source: Addgene
  

http://www.addgene.org/52708

Genetic Insert: ΔYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacY and lacA deletion

Proper citation: RRID:Addgene_52708 Copy   

•   Source: Addgene