Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
EH1 Resource Report Resource Website |
RRID:Addgene_102804 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= thrC ilvA Precursor strain = RF2 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Thr, Ile EH1 requires L-Thr and L-Ile for growth in M63 minimal medium Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:01:38 | 0 | ||
|
RF16 Resource Report Resource Website |
RRID:Addgene_102800 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB cysE Precursor strain = RF15 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser, Cys++++++, Ala++++++ ++++++ RF16 grows slowly in the LB medium, does NOT grow in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys. RF16 (but not RF15) grows very slowly in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser, L-Cys plus L-Ala. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:01:38 | 0 | ||
|
RF17 Resource Report Resource Website |
RRID:Addgene_102801 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:01:38 | 0 | ||
|
BL21 ΔrecB Resource Report Resource Website |
RRID:Addgene_176580 | Strain | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recB genomic deletion | Addgene | 2026-10-24 02:11:03 | 0 | |
|
KTD101(DE3) Resource Report Resource Website |
RRID:Addgene_138651 | None | E. coli | None | PMID:31772280 | Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514 KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941. Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter. The parent strain KTD101 was provided by François Baneyx at the University of Washington. DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:21:53 | 0 | |
|
BA14 Resource Report Resource Website |
RRID:Addgene_186997 | bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N | E. coli | None | PMID:16979134 | Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:22:36 | 0 | |
|
MG1655-OptoCre-cat-T172A-P-R Resource Report Resource Website |
RRID:Addgene_188480 | P-R-lox-TT-lox-catT172A | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:23:42 | 0 | ||
|
MG1655-OptoCre-tetA-Ptet-Rtet Resource Report Resource Website |
RRID:Addgene_188481 | Ptet-Rtet-lox-TT-lox-tetA | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:23:42 | 0 | ||
|
MG1655-OptoCre-knt-P**-R Resource Report Resource Website |
RRID:Addgene_188477 | P**-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:23:42 | 0 | ||
|
MG1655-OptoCre-knt-P-R* Resource Report Resource Website |
RRID:Addgene_188478 | P-R*-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:23:42 | 0 | ||
|
MG1655-OptoCre-cat-P-R Resource Report Resource Website |
RRID:Addgene_188479 | P-R-lox-TT-lox-cat | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:23:42 | 0 | ||
|
MG1655 Z1 malE clpA Resource Report Resource Website |
RRID:Addgene_65918 | MG1655 Z1 malE clpA | None | PMID:26900850 | F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, clpA- | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:17:40 | 0 | ||
|
MG1655 Z1 malE aat Resource Report Resource Website |
RRID:Addgene_65917 | MG1655 Z1 malE aat | None | PMID:26900850 | F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-, aat- | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:17:40 | 0 | ||
|
CY008 Resource Report Resource Website |
RRID:Addgene_72401 | None | PMID:26315440 | No antibiotic resistance. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:18:30 | 0 | |||
|
Strain SIJ_488 Resource Report Resource Website 1+ mentions |
RRID:Addgene_68246 | arabinose inducible lambda Red recombineering genes, rhamnose inducible flippase recombinase and m-toluic acid inducible I-SceI. | None | PMID:26643270 | E. coli K-12 MG1655 with genomically integrated arabinose inducible lambda Red recombineering genes, rhamnose inducible flippase recombinase and m-toluic acid inducible I-SceI. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-24 02:17:57 | 1 | ||
|
HL 1951 Resource Report Resource Website |
RRID:Addgene_69773 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-10-24 02:18:09 | 0 | ||||
|
HL 6779 Resource Report Resource Website |
RRID:Addgene_69783 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-10-24 02:18:09 | 0 | ||||
|
HL 6776 Resource Report Resource Website |
RRID:Addgene_69780 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-10-24 02:18:09 | 0 | ||||
|
HL 6825 Resource Report Resource Website |
RRID:Addgene_69784 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-10-24 02:18:09 | 0 | ||||
|
B95(DE3) ΔA ΔfabR ΔserB Resource Report Resource Website 1+ mentions |
RRID:Addgene_197655 | This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo | n/a | None | PMID:31243963 | Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672 | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | Addgene | 2026-10-24 02:24:30 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
