Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Xenopus laevis
Genetic Insert: glycogen synthase kinase 3
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29680 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2X-T has a TEV-cleavable N-terminal His6-gamma crystallin fusion tag. Gamma crystallin can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29714 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4975; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2P-T has a TEV-cleavable N-terminal His6-Protein G fusion tag. Protein G can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29713 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5131; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2T-T has a TEV-cleavable N-terminal His6-thioredoxin fusion tag. Thioredoxin can improve the solubility of your target protein by promoting correct disulfide bond formation.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29712 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2O-T has a TEV-cleavable N-terminal His6-Mocr fusion tag. Mocr can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29710 Copy
Species: Homo sapiens
Genetic Insert: Pak3
Vector Backbone Description: Backbone Size:4645; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_29676 Copy
Species:
Genetic Insert: GFP glycogen synthase kinase 3 recognition site E3 ligase site mutated primed by MAPK
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This construct was generated by addition of the following sequence to the C-terminus of GFP:AAASAAASAAASAPASPAAAAAAAAAAAADYKDDDDK
Proper citation: RRID:Addgene_29691 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29609 Copy
Species: Homo sapiens
Genetic Insert: FUS RRM mutant
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29608 Copy
Species:
Genetic Insert: GFP glycogen synthase kinase 3 recognition site primed by MAPK
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This artificial GFP-GSK3-MAPK construct was generated by adding to the C terminus of GFP synthetic oligonucleotides encoding for AAASAAASAAASAPASPAAAAAAAAPPAYDYKDDDDK. See Figure 6A of the associated publication for more details.
Proper citation: RRID:Addgene_29689 Copy
Species: canis familiaris
Genetic Insert: RAB5A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_29688 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Backbone Size:8106; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol.
Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile.
To clone into this vector, add SLIC tags to the 5' end of your PCR primers.
Forward - 5'GTGCTGTTCCAGGGTCCGAAT3'
Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3'
Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel.
When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29721 Copy
Species: Homo sapiens
Genetic Insert: jun B oncogene
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29687 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Backbone Size:6969; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol.
Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile.
To clone into this vector, add SLIC tags to the 5' end of your PCR primers.
Forward - 5'GTGCTGTTCCAGGGTCCGAAT3'
Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3'
Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel.
When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29720 Copy
Species: Homo sapiens
Genetic Insert: hepatocyte growth factor-regulated tyrosine kinase substrate
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29685 Copy
Species: Homo sapiens
Genetic Insert: LDL-receptor related protein 6
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29682 Copy
Species: Xenopus laevis
Genetic Insert: glycogen synthase kinase 3
Vector Backbone Description: Backbone Size:4096; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_29681 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Backbone Size:5661; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Sumo can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29659 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Backbone Size:5712; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Mocr can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29658 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Backbone Size:6846; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. NusA can enhance the expression and solubility of your protein.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29657 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within nidm-terms that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
