Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 52 showing 1021 ~ 1040 out of 178,636 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_161975

http://www.addgene.org/161975

Genetic Insert: GFP-aid-GSlinker
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pGEMT; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33091336

Proper citation: RRID:Addgene_161975 Copy   

http://www.addgene.org/161979

Genetic Insert: puroR-p2a-HA-halo-GSlinker
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pGEMT; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33091336

Proper citation: RRID:Addgene_161979 Copy   

    • RRID:Addgene_162042

    This resource has 1+ mentions.

http://www.addgene.org/162042

Species: Synthetic
Genetic Insert: natR412 guide
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: GTACCGCACCAGTGTCCCGG

Proper citation: RRID:Addgene_162042 Copy   

    • RRID:Addgene_162163

    This resource has 1+ mentions.

http://www.addgene.org/162163

Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33436886
Comments: https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1

Proper citation: RRID:Addgene_162163 Copy   

    • RRID:Addgene_162041

    This resource has 1+ mentions.

http://www.addgene.org/162041

Species: Synthetic
Genetic Insert: kanR468 guide
Vector Backbone Description: Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: TCCATGTTGGAATTTAATCG

Proper citation: RRID:Addgene_162041 Copy   

    • RRID:Addgene_162161

    This resource has 1+ mentions.

http://www.addgene.org/162161

Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Backbone Marker:Drosophila Genomics Resource Center; Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33436886
Comments: https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1

Proper citation: RRID:Addgene_162161 Copy   

    • RRID:Addgene_162074

    This resource has 1+ mentions.

http://www.addgene.org/162074

Species: Mus musculus
Genetic Insert: Cas9-2a-blasticidin S deaminase
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:8504; Vector Backbone:pLX311; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33497609

Proper citation: RRID:Addgene_162074 Copy   

    • RRID:Addgene_16227

http://www.addgene.org/16227

Species: Homo sapiens
Genetic Insert: Snail
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15448698
Comments: Also see GFP Snail WT author's map.

Proper citation: RRID:Addgene_16227 Copy   

    • RRID:Addgene_16226

    This resource has 1+ mentions.

http://www.addgene.org/16226

Species: Homo sapiens
Genetic Insert: Snail
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15448698
Comments: Also see GFP Snail WT author's map.

Proper citation: RRID:Addgene_16226 Copy   

    • RRID:Addgene_16221

    This resource has 1+ mentions.

http://www.addgene.org/16221

Species: Homo sapiens
Genetic Insert: Snail
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag 2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15448698
Comments: Also see Flag Snail WT author's map.

Proper citation: RRID:Addgene_16221 Copy   

    • RRID:Addgene_162069

http://www.addgene.org/162069

Species: Danio rerio
Genetic Insert: beta actin 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7903; Vector Backbone:pDestTol2pA; Vector Types:Gateway Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23934216

Proper citation: RRID:Addgene_162069 Copy   

    • RRID:Addgene_1621

    This resource has 1+ mentions.

http://www.addgene.org/1621

Vector Backbone Description: Backbone Size:5536; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD122.11, Ligation number L4040.

Proper citation: RRID:Addgene_1621 Copy   

http://www.addgene.org/162130

Species: Homo sapiens
Genetic Insert: sgACSL4
Vector Backbone Description: Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32029897

Proper citation: RRID:Addgene_162130 Copy   

    • RRID:Addgene_162250

    This resource has 1+ mentions.

http://www.addgene.org/162250

Species: Synthetic
Genetic Insert: eMagB-iRFP-OMP25
Vector Backbone Description: Backbone Size:5903; Vector Backbone:M18 pCAGGS WPRE electroporation vector (Gray et al., 2016); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33174843
Comments: Please visit https://doi.org/10.1101/2020.08.28.272807 for bioRxiv preprint.

Proper citation: RRID:Addgene_162250 Copy   

    • RRID:Addgene_162253

http://www.addgene.org/162253

Species: Synthetic
Genetic Insert: eMagBF-TgRFPT
Vector Backbone Description: Backbone Size:5363; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33174843
Comments: Please visit https://doi.org/10.1101/2020.08.28.272807 for bioRxiv preprint.

Proper citation: RRID:Addgene_162253 Copy   

    • RRID:Addgene_16207

http://www.addgene.org/16207

Species: Homo sapiens
Genetic Insert: HtrA2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4950; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14512424

Proper citation: RRID:Addgene_16207 Copy   

    • RRID:Addgene_162255

    This resource has 1+ mentions.

http://www.addgene.org/162255

Species: Synthetic
Genetic Insert: TagRFP-T-VAPB(1- 218)- eMagB
Vector Backbone Description: Backbone Size:5898; Vector Backbone:M18 pCAGGS WPRE electroporation vector (Gray et al., 2016); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33174843
Comments: Please visit https://doi.org/10.1101/2020.08.28.272807 for bioRxiv preprint.

Proper citation: RRID:Addgene_162255 Copy   

    • RRID:Addgene_16205

    This resource has 1+ mentions.

http://www.addgene.org/16205

Species: Homo sapiens
Genetic Insert: BRIT1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16872911

Proper citation: RRID:Addgene_16205 Copy   

    • RRID:Addgene_16204

    This resource has 1+ mentions.

http://www.addgene.org/16204

Species: Mus musculus
Genetic Insert: Per2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4500; Vector Backbone:pCMV-Sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9428527

Proper citation: RRID:Addgene_16204 Copy   

    • RRID:Addgene_162258

http://www.addgene.org/162258

Species: Homo sapiens
Genetic Insert: MECP2
Vector Backbone Description: Backbone Marker:SGC (Addgene Plasmid ##26117); Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: N-terminal tag AA:M. C-terminal tag AA:AHHHHHH. SGC Clone ID:MECP2:JMC138-F02:C241484. SGC Clone ID:http://www.thesgc.org/structures/6OGJ/

Proper citation: RRID:Addgene_162258 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

NIDM Terminology

Recent News Entries

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch