Plasmids   Select Another Resource Report Type

http://www.addgene.org/71462

Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2958; Vector Backbone:pUC57KAN; Vector Types:Mammalian Expression, Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26849369

Proper citation: RRID:Addgene_71462 Copy   

•   Source: Addgene

http://www.addgene.org/71461

Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET21(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16074986
Comments: This plasmid contains the CAT gene, which can be replaced with your gene of interest using the unique BsrG I site (TGTACA) at the end of the intein and one of several sites downstream from the product protein (typically Hind III). More info on cloning can be found in supplemental document ELP cloning manual. Please NOTE- the Addgene diagnostic digest result confirms the presence of ELP-intein.

Proper citation: RRID:Addgene_71461 Copy   

•   Source: Addgene

http://www.addgene.org/71467

Species: Homo sapiens
Genetic Insert: SUMO1/sentrin specific peptidase 3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5329; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26522917

Proper citation: RRID:Addgene_71467 Copy   

•   Source: Addgene

http://www.addgene.org/71503

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25517091
Comments: This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal.

Proper citation: RRID:Addgene_71503 Copy   

•   Source: Addgene

http://www.addgene.org/71504

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25517091
Comments: This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal.

Proper citation: RRID:Addgene_71504 Copy   

•   Source: Addgene

http://www.addgene.org/71468

Species: Homo sapiens
Genetic Insert: SUMO1/sentrin specific peptidase 5
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5289; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26522917
Comments: Insert gene optimisation performed by Genscript

Proper citation: RRID:Addgene_71468 Copy   

•   Source: Addgene

http://www.addgene.org/71469

Species: Homo sapiens
Genetic Insert: SUMO1/sentrin specific peptidase 6
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5289; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26522917
Comments: Insert gene optimisation performed by Genscript

Proper citation: RRID:Addgene_71469 Copy   

•   Source: Addgene

http://www.addgene.org/71502

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25517091
Comments: This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal.

Proper citation: RRID:Addgene_71502 Copy   

•   Source: Addgene

http://www.addgene.org/71507

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq validation vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25517091

Proper citation: RRID:Addgene_71507 Copy   

•   Source: Addgene

http://www.addgene.org/71508

Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq validation vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25517091

Proper citation: RRID:Addgene_71508 Copy   

•   Source: Addgene

http://www.addgene.org/71453

Species: Homo sapiens
Genetic Insert: STAT1
Vector Backbone Description: Backbone Marker:Andrei Gudkov lab; Vector Backbone:pLV-tetO-CMV-SV40-puro-LoxP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19478064

Proper citation: RRID:Addgene_71453 Copy   

•   Source: Addgene

http://www.addgene.org/71459

Species: Mus musculus
Genetic Insert: TRAF3IP3
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pcDNA-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26195727

Proper citation: RRID:Addgene_71459 Copy   

•   Source: Addgene

http://www.addgene.org/71458

Species: Mus musculus
Genetic Insert: Slc1a5
Vector Backbone Description: Backbone Marker:Obtained from Dr. Inder Verma and modified in Dr. Shao-Cong's lab. Addgene Plasmid #27557; Backbone Size:8000; Vector Backbone:pCLXSN-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24792914
Comments: We transferred the Slc1a5 insert from the pCLXSN vector. The differences in Slc1a5 compared to GenBank reference sequence NM_009201.2 do not affect the function of the plasmid.

Proper citation: RRID:Addgene_71458 Copy   

•   Source: Addgene

http://www.addgene.org/71484

Genetic Insert: sgPal7
Vector Backbone Description: Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26527385

Proper citation: RRID:Addgene_71484 Copy   

•   Source: Addgene

http://www.addgene.org/71485

Vector Backbone Description: Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26527385

Proper citation: RRID:Addgene_71485 Copy   

•   Source: Addgene

http://www.addgene.org/71400

Species: Homo sapiens
Genetic Insert: HDAC4 C-terminus
Vector Backbone Description: Backbone Marker:Addgene plasmid #11160; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26272629

Proper citation: RRID:Addgene_71400 Copy   

•   Source: Addgene

http://www.addgene.org/71401

Species: Homo sapiens
Genetic Insert: HDAC4 1-129
Vector Backbone Description: Backbone Marker:Addgene plasmid #11160; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26272629

Proper citation: RRID:Addgene_71401 Copy   

•   Source: Addgene

http://www.addgene.org/71489

Genetic Insert: spCas9
Vector Backbone Description: Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26527385

Proper citation: RRID:Addgene_71489 Copy   

•   Source: Addgene

http://www.addgene.org/71486

Species: Synthetic
Genetic Insert: loxP-hyg-loxP cassette
Vector Backbone Description: Backbone Marker:Kenan Murphy; Backbone Size:2741; Vector Backbone:pKM328; Vector Types:Bacterial Expression, Source of loxP-hyg-loxP for PCR amplification.; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25779316
Comments: The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences: CGCTCTAGAACTAGTGGATCC ATGCCTGCAGGTCGACTC

Proper citation: RRID:Addgene_71486 Copy   

•   Source: Addgene

http://www.addgene.org/71487

Species: Other
Genetic Insert: loxP-hyg-cat-loxP
Vector Backbone Description: Backbone Marker:Jeffery Murry - Eric Rubin Lab; Vector Backbone:pJM1; Vector Types:Bacterial Expression, Source of loxP-hyg-cat- loxP for PCR amplification.; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25779316
Comments: This vector contains a hyg-cat cassette, flanked by loxP sites, that can be used for the construction of recombineeng substrates for M. smegmatis or M. tuberculosis. It contains a 1 bp change (relative to starting plasmid pJM1) at position 2008 (G to C) that eliminate a potential stop codon that could interfere with expression of downstream functions following excision of the cassette from the chromosome by Cre recombinase. The hygromycin resistance gene encodes M13I and I111T variants compared to the NCBI reference [ADL66925.1]. These variants should not interfere with function.

Proper citation: RRID:Addgene_71487 Copy   

•   Source: Addgene