Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pU6T7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71462 | Kanamycin | PMID:26849369 | Backbone Marker:Genscript; Backbone Size:2958; Vector Backbone:pUC57KAN; Vector Types:Mammalian Expression, Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:43 | 2 | ||||
|
pET/ELP-I-CAT Resource Report Resource Website 1+ mentions |
RRID:Addgene_71461 | Ampicillin | PMID:16074986 | This plasmid contains the CAT gene, which can be replaced with your gene of interest using the unique BsrG I site (TGTACA) at the end of the intein and one of several sites downstream from the product protein (typically Hind III). More info on cloning can be found in supplemental document ELP cloning manual. Please NOTE- the Addgene diagnostic digest result confirms the presence of ELP-intein. | Backbone Marker:Novagen; Vector Backbone:pET21(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 1 | |||
|
pET28a-HsSENP3 Resource Report Resource Website |
RRID:Addgene_71467 | SUMO1/sentrin specific peptidase 3 | Homo sapiens | Kanamycin | PMID:26522917 | Backbone Marker:Novagen; Backbone Size:5329; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Gene optimised for E. coli expression (Genscript) | 2026-08-29 01:09:43 | 0 | |
|
pSTARR-seq_fly-pnr Resource Report Resource Website |
RRID:Addgene_71503 | Chloramphenicol and Ampicillin | PMID:25517091 | This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal. | Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:09:43 | 0 | |||
|
pSTARR-seq_fly-RpS12 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71504 | Chloramphenicol and Ampicillin | PMID:25517091 | This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal. | Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:09:43 | 1 | |||
|
pET28a-HsSENP5 Resource Report Resource Website |
RRID:Addgene_71468 | SUMO1/sentrin specific peptidase 5 | Homo sapiens | Kanamycin | PMID:26522917 | Insert gene optimisation performed by Genscript | Backbone Marker:Novagen; Backbone Size:5289; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Gene optimised for E. coli expression (Genscript) | 2026-08-29 01:09:43 | 0 |
|
pET28a-HsSENP6 Resource Report Resource Website |
RRID:Addgene_71469 | SUMO1/sentrin specific peptidase 6 | Homo sapiens | Kanamycin | PMID:26522917 | Insert gene optimisation performed by Genscript | Backbone Marker:Novagen; Backbone Size:5289; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Gene optimised for E. coli expression (Genscript) | 2026-08-29 01:09:43 | 0 |
|
pSTARR-seq_fly-NipB Resource Report Resource Website |
RRID:Addgene_71502 | Chloramphenicol and Ampicillin | PMID:25517091 | This plasmid was made by replacing the sequence of pGL3-Promoter between BglII and FseI with a fragment containing the core promoter listed above, an mhc16 intron, an ORF (sgGFP, Qbiogene, Inc), a ccdB suicide gene flanked by homology arms (used for cloning the enhancer candidates during library generation), followed by the pGL3's SV40 late polyA-signal. | Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:09:43 | 0 | |||
|
pGL3-DSCP-Gateway Resource Report Resource Website |
RRID:Addgene_71507 | Chloramphenicol and Ampicillin | PMID:25517091 | Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq validation vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:09:43 | 0 | ||||
|
pGL3-RpS12-Gateway Resource Report Resource Website |
RRID:Addgene_71508 | Chloramphenicol and Ampicillin | PMID:25517091 | Backbone Marker:Promega; Vector Backbone:pGL3-Promoter; Vector Types:Insect Expression, flySTARR-seq validation vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:09:43 | 0 | ||||
|
pLV-Y701F-STAT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71453 | STAT1 | Homo sapiens | Ampicillin | PMID:19478064 | Backbone Marker:Andrei Gudkov lab; Vector Backbone:pLV-tetO-CMV-SV40-puro-LoxP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Y701F | 2026-08-29 01:09:43 | 2 | |
|
pcDNA-HA-TRAF3IP3 (mouse) Resource Report Resource Website |
RRID:Addgene_71459 | TRAF3IP3 | Mus musculus | Ampicillin | PMID:26195727 | Backbone Size:4700; Vector Backbone:pcDNA-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 0 | ||
|
pCLXSN(GFP)-HA-Slc1a5 (mouse) Resource Report Resource Website 1+ mentions |
RRID:Addgene_71458 | Slc1a5 | Mus musculus | Ampicillin | PMID:24792914 | We transferred the Slc1a5 insert from the pCLXSN vector. The differences in Slc1a5 compared to GenBank reference sequence NM_009201.2 do not affect the function of the plasmid. | Backbone Marker:Obtained from Dr. Inder Verma and modified in Dr. Shao-Cong's lab. Addgene Plasmid #27557; Backbone Size:8000; Vector Backbone:pCLXSN-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | A85P, L125F and V384A mutations compared to GenBank reference sequence NM_009201.2 | 2026-08-29 01:09:43 | 1 |
|
sgPal7 (p2Tol-U6-sgPal7-HygR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_71484 | sgPal7 | Ampicillin | PMID:26527385 | Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 3 | |||
|
sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_71485 | Ampicillin | PMID:26527385 | Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 6 | ||||
|
pCAG-HDAC4 C-terminus Resource Report Resource Website |
RRID:Addgene_71400 | HDAC4 C-terminus | Homo sapiens | Ampicillin | PMID:26272629 | Backbone Marker:Addgene plasmid #11160; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 0 | ||
|
pCAG-HDAC4 1-129 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71401 | HDAC4 1-129 | Homo sapiens | Ampicillin | PMID:26272629 | Backbone Marker:Addgene plasmid #11160; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 1 | ||
|
spCas9-BlastR (pCBhCas9-BlastR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_71489 | spCas9 | Ampicillin | PMID:26527385 | Vector Backbone:p2Tol2; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 4 | |||
|
pKM342 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71486 | loxP-hyg-loxP cassette | Synthetic | Ampicillin | PMID:25779316 | The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences: CGCTCTAGAACTAGTGGATCC ATGCCTGCAGGTCGACTC | Backbone Marker:Kenan Murphy; Backbone Size:2741; Vector Backbone:pKM328; Vector Types:Bacterial Expression, Source of loxP-hyg-loxP for PCR amplification.; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 2 | |
|
pKM343 Resource Report Resource Website |
RRID:Addgene_71487 | loxP-hyg-cat-loxP | Other | Chloramphenicol | PMID:25779316 | This vector contains a hyg-cat cassette, flanked by loxP sites, that can be used for the construction of recombineeng substrates for M. smegmatis or M. tuberculosis. It contains a 1 bp change (relative to starting plasmid pJM1) at position 2008 (G to C) that eliminate a potential stop codon that could interfere with expression of downstream functions following excision of the cassette from the chromosome by Cre recombinase. The hygromycin resistance gene encodes M13I and I111T variants compared to the NCBI reference [ADL66925.1]. These variants should not interfere with function. | Backbone Marker:Jeffery Murry - Eric Rubin Lab; Vector Backbone:pJM1; Vector Types:Bacterial Expression, Source of loxP-hyg-cat- loxP for PCR amplification.; Bacterial Resistance:Chloramphenicol | 2026-08-29 01:09:43 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
