Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 40 showing 781 ~ 800 out of 739,718 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_17465

    This resource has 1+ mentions.

http://www.addgene.org/17465

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3023; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal ECFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826

Proper citation: RRID:Addgene_17465 Copy   


http://www.addgene.org/174665

Species: Synthetic
Genetic Insert: LUC2
Vector Backbone Description: Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_174665 Copy   


http://www.addgene.org/17468

Species: Homo sapiens
Genetic Insert: Bnip3L RNAi
Vector Backbone Description: Backbone Size:6349; Vector Backbone:pSuper-retro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15607964
Comments: Target sequence: AACAGTTCCTGGGTGGAGCTA

Proper citation: RRID:Addgene_17468 Copy   


  • RRID:Addgene_174618

http://www.addgene.org/174618

Species: Synthetic
Genetic Insert: mtrCAB
Vector Backbone Description: Backbone Size:3903; Vector Backbone:pET-28a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern.

Proper citation: RRID:Addgene_174618 Copy   


http://www.addgene.org/174692

Species: Staphylococcus aureus and Escherichia coli
Genetic Insert: Anti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7382; Vector Backbone:pET301/NT-DEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36742360

Proper citation: RRID:Addgene_174692 Copy   


http://www.addgene.org/174610

Species: Homo sapiens
Genetic Insert: human CD19, antigen minigene
Vector Backbone Description: Vector Backbone:MP71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174610 Copy   


  • RRID:Addgene_174608

http://www.addgene.org/174608

Genetic Insert: membrane GFP fused to LLO and mouse PMEL antigen
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174608 Copy   


  • RRID:Addgene_174602

http://www.addgene.org/174602

Genetic Insert: Constitutive expression of secreted murine IFN gamma
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174602 Copy   


http://www.addgene.org/174603

Genetic Insert: extracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174603 Copy   


http://www.addgene.org/174605

Genetic Insert: palmytoylGFP w/C-term fusion LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 Lama4
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174605 Copy   


  • RRID:Addgene_174682

http://www.addgene.org/174682

Species: Prevotella disiens
Genetic Insert: huPdCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #69990) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174682 Copy   


  • RRID:Addgene_174685

http://www.addgene.org/174685

Species: Eubacterium rectale
Genetic Insert: huErCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Stephen Ekker Lab (Addgene #132641) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174685 Copy   


http://www.addgene.org/174686

Species: Prevotella bryantii B14
Genetic Insert: huPb2Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92272) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174686 Copy   


  • RRID:Addgene_174687

http://www.addgene.org/174687

Species: Thiomicrospira sp. XS5
Genetic Insert: huTsCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92267) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174687 Copy   


http://www.addgene.org/174634

Species: Mus musculus
Genetic Insert: KIF1A(1-365)-VVDfast-mCherry-SSPB(micro)
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN444

Proper citation: RRID:Addgene_174634 Copy   


http://www.addgene.org/174637

Species: Mus musculus
Genetic Insert: KIF1A(1-365)-VVDfast-mVenus-SSPB(micro)
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN365

Proper citation: RRID:Addgene_174637 Copy   


http://www.addgene.org/174592

Species: Homo sapiens
Genetic Insert: ubiquitination sgRNA
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene plasmid # 52961); Vector Backbone:lentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31692446

Proper citation: RRID:Addgene_174592 Copy   


  • RRID:Addgene_174596

    This resource has 1+ mentions.

http://www.addgene.org/174596

Genetic Insert: GM-CSF
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174596 Copy   


http://www.addgene.org/174598

Genetic Insert: membrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174598 Copy   


http://www.addgene.org/174631

Species: Mus musculus
Genetic Insert: KIF1A(1-365)-VVDfast-GFP-SSPB(micro)
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN273

Proper citation: RRID:Addgene_174631 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X