Plasmids   Select Another Resource Report Type

http://www.addgene.org/160261

Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:32955754
Comments: Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid

Proper citation: RRID:Addgene_160261 Copy   

•   Source: Addgene

http://www.addgene.org/160262

Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:32955754
Comments: Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid

Proper citation: RRID:Addgene_160262 Copy   

•   Source: Addgene

http://www.addgene.org/160171

Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:32955754
Comments: Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid

Proper citation: RRID:Addgene_160171 Copy   

•   Source: Addgene

http://www.addgene.org/160169

Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:32955754
Comments: Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid

Proper citation: RRID:Addgene_160169 Copy   

•   Source: Addgene

http://www.addgene.org/123186

Species: Catharanthus roseus
Genetic Insert: Catharanthus roseus STR1 promoter and 5'UTR
Vector Backbone Description: Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression, part for plant expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:31263474
Comments: Golden Gate (MoClo; PRO + 5U) compatible STR1 promoter from Catharanthus roseus. Can be used as a control for transactivation experiments. Confirmed activation through ORCA3 and repression through ZCT1

Proper citation: RRID:Addgene_123186 Copy   

•   Source: Addgene

http://www.addgene.org/123185

Species: Catharanthus roseus
Genetic Insert: ORCA3 from Catharanthus roseus
Vector Backbone Description: Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Backbone Size:2247; Vector Backbone:pICH41308; Vector Types:Plant Expression, part for plant expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:31263474
Comments: Golden Gate (MoClo - Weber et al., 2011), CDS1 position, Octadecanoid-Responsive Catharanthus AP2 (ORCA3, GenBank: EU072424.1); activator of the Catharanthus roseus STR1 promoter

Proper citation: RRID:Addgene_123185 Copy   

•   Source: Addgene

http://www.addgene.org/187872

Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Keunsub Lee; Backbone Size:6149; Vector Backbone:pTF505; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35690588

Proper citation: RRID:Addgene_187872 Copy   

•   Source: Addgene

http://www.addgene.org/183241

Species: Escherichia coli
Genetic Insert: sgRNA-FRT
Vector Backbone Description: Vector Backbone:pSC101 rep-ts; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35411846

Proper citation: RRID:Addgene_183241 Copy   

•   Source: Addgene

http://www.addgene.org/239460

Vector Backbone Description: Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:40864707
Comments: For cloning a promoter + gene fragment (without stop codon) via Gibson Assembly, we recommend the following approach: Primer design: Forward primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC PRIMER 3’ Reverse primer:  5’ CAGAACCACCACCTCCGGATCC+GENE SPECIFIC PRIMER W/O STOP CODON 3' Digest pMDS1 plasmid with SAP I enzyme Clean up Perform Gibson assembly reaction Transform E. coli (DH5alpha) Select on LB + Sp + Sm

Proper citation: RRID:Addgene_239460 Copy   

•   Source: Addgene

http://www.addgene.org/239459

Vector Backbone Description: Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:40864707
Comments: Two cloning steps are required for the generation of a "promoter:3xHA:VENUS:GENE:2A:mTurqN7" fragment: A) Cloning of promoter: Primer design: Forward Primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC SEQUENCE 3’ Reverse primer: 5’ GATGGGCATTAACATCTTTTAC+PROMOTER SPECIFIC SEQUENCE 3' Digest plasmid with SapI Clean Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm (blue/white selection) B) Cloning of gene fragment: Forward Primer: 5’GTTCTGGTGGGGGTGGCTCC+ GENE SPECIFIC SEQUENCE (starting from the ATG) 3’ Reverse primer:  5’ AACAGCTGGCCCGAGCCACC+GENE SPECIFIC SEQUENCE (without STOP Codon) 3' Digest plasmid with Bsu36I and perform gel purification Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm The discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.

Proper citation: RRID:Addgene_239459 Copy   

•   Source: Addgene

http://www.addgene.org/190156

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:36129831

Proper citation: RRID:Addgene_190156 Copy   

•   Source: Addgene

http://www.addgene.org/193370

Vector Backbone Description: Vector Backbone:pK7WG2; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:40083573
Comments: Multisite Gateway destination vector to express ORFs from entry clones. RPS5A promoter and SV40 nuclear localization signal in front of attR1. HSP terminator at the downstream of attR5. Kanamycin-resistant gene and Ole1-GFP for screening of transformants. Please visit https://doi.org/10.1101/2023.02.27.530312 for bioRxiv preprint.

Proper citation: RRID:Addgene_193370 Copy   

•   Source: Addgene

http://www.addgene.org/200213

Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200213 Copy   

•   Source: Addgene

http://www.addgene.org/200214

Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200214 Copy   

•   Source: Addgene

http://www.addgene.org/200215

Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200215 Copy   

•   Source: Addgene

http://www.addgene.org/216387

Species: Mus musculus
Genetic Insert: Dishevelled-2
Vector Backbone Description: Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35998232

Proper citation: RRID:Addgene_216387 Copy   

•   Source: Addgene

http://www.addgene.org/216386

Species: Mus musculus
Genetic Insert: Dishevelled-2
Vector Backbone Description: Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35998232

Proper citation: RRID:Addgene_216386 Copy   

•   Source: Addgene

http://www.addgene.org/218172

Species: Other
Genetic Insert: TALE-Intron-hA3A-Y130F-DddA full (E1347A)-UGI
Vector Backbone Description: Vector Backbone:pYPQ121; Vector Types:Plant Expression, Plastid base editing; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:38709858

Proper citation: RRID:Addgene_218172 Copy   

•   Source: Addgene

http://www.addgene.org/218174

Species: Other
Genetic Insert: TALE-Intron-N-DddAtox half (G1397N)-UGI-T2A-TALE-C-DddAtox half (G1397C)-UGI
Vector Backbone Description: Vector Backbone:pYPQ121; Vector Types:Plant Expression, Plastid base editing; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:38709858

Proper citation: RRID:Addgene_218174 Copy   

•   Source: Addgene

http://www.addgene.org/221134

Species: Synthetic
Genetic Insert: [PibpA-gfpASV]
Vector Backbone Description: Backbone Marker:Standard European Vector Architecture; Vector Backbone:pSEVA631; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:38676700

Proper citation: RRID:Addgene_221134 Copy   

•   Source: Addgene