Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
25 pCOLI_S_NoTag Resource Report Resource Website |
RRID:Addgene_160261 | Spectinomycin and Streptomycin | PMID:32955754 | Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid | Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:25:34 | 0 | |||
|
28 pCOLI_S_STREP Resource Report Resource Website |
RRID:Addgene_160262 | Spectinomycin and Streptomycin | PMID:32955754 | Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid | Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:25:34 | 0 | |||
|
29 pCOLI_S_C_STREP Resource Report Resource Website |
RRID:Addgene_160171 | Spectinomycin and Streptomycin | PMID:32955754 | Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid | Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:25:33 | 0 | |||
|
27 pCOLI_S_C_HIS Resource Report Resource Website |
RRID:Addgene_160169 | Spectinomycin and Streptomycin | PMID:32955754 | Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid | Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:25:33 | 0 | |||
|
pSB62 - pL0_STR (pro + 5U) Resource Report Resource Website |
RRID:Addgene_123186 | Catharanthus roseus STR1 promoter and 5'UTR | Catharanthus roseus | Spectinomycin and Streptomycin | PMID:31263474 | Golden Gate (MoClo; PRO + 5U) compatible STR1 promoter from Catharanthus roseus. Can be used as a control for transactivation experiments. Confirmed activation through ORCA3 and repression through ZCT1 | Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression, part for plant expression; Bacterial Resistance:Spectinomycin and Streptomycin | No BpiI and BsaI sites | 2026-09-01 09:15:29 | 0 |
|
pSB142 - pL0_ORCA3 (CDS1) Resource Report Resource Website |
RRID:Addgene_123185 | ORCA3 from Catharanthus roseus | Catharanthus roseus | Spectinomycin and Streptomycin | PMID:31263474 | Golden Gate (MoClo - Weber et al., 2011), CDS1 position, Octadecanoid-Responsive Catharanthus AP2 (ORCA3, GenBank: EU072424.1); activator of the Catharanthus roseus STR1 promoter | Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Backbone Size:2247; Vector Backbone:pICH41308; Vector Types:Plant Expression, part for plant expression; Bacterial Resistance:Spectinomycin and Streptomycin | No BpiI and BsaI sites | 2026-09-01 09:15:29 | 0 |
|
pEA106 Resource Report Resource Website |
RRID:Addgene_187872 | mCherry | Other | Spectinomycin and Streptomycin | PMID:35690588 | Backbone Marker:Keunsub Lee; Backbone Size:6149; Vector Backbone:pTF505; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:32:51 | 0 | ||
|
pKDsgRNA-FRT Resource Report Resource Website 1+ mentions |
RRID:Addgene_183241 | sgRNA-FRT | Escherichia coli | Spectinomycin and Streptomycin | PMID:35411846 | Vector Backbone:pSC101 rep-ts; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:31:34 | 1 | ||
|
pMDS1 Resource Report Resource Website |
RRID:Addgene_239460 | Spectinomycin and Streptomycin | PMID:40864707 | For cloning a promoter + gene fragment (without stop codon) via Gibson Assembly, we recommend the following approach: Primer design: Forward primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC PRIMER 3’ Reverse primer: 5’ CAGAACCACCACCTCCGGATCC+GENE SPECIFIC PRIMER W/O STOP CODON 3' Digest pMDS1 plasmid with SAP I enzyme Clean up Perform Gibson assembly reaction Transform E. coli (DH5alpha) Select on LB + Sp + Sm | Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:47:04 | 0 | |||
|
pMDS2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_239459 | Spectinomycin and Streptomycin | PMID:40864707 | Two cloning steps are required for the generation of a "promoter:3xHA:VENUS:GENE:2A:mTurqN7" fragment: A) Cloning of promoter: Primer design: Forward Primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC SEQUENCE 3’ Reverse primer: 5’ GATGGGCATTAACATCTTTTAC+PROMOTER SPECIFIC SEQUENCE 3' Digest plasmid with SapI Clean Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm (blue/white selection) B) Cloning of gene fragment: Forward Primer: 5’GTTCTGGTGGGGGTGGCTCC+ GENE SPECIFIC SEQUENCE (starting from the ATG) 3’ Reverse primer: 5’ AACAGCTGGCCCGAGCCACC+GENE SPECIFIC SEQUENCE (without STOP Codon) 3' Digest plasmid with Bsu36I and perform gel purification Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm The discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. | Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:47:04 | 1 | |||
|
pCrepusculo Resource Report Resource Website |
RRID:Addgene_190156 | Spectinomycin and Streptomycin | PMID:36129831 | Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:33:21 | 0 | ||||
|
pDESTpK7WG2-RPS5Ap-NLS-OleGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_193370 | Spectinomycin and Streptomycin | PMID:40083573 | Multisite Gateway destination vector to express ORFs from entry clones. RPS5A promoter and SV40 nuclear localization signal in front of attR1. HSP terminator at the downstream of attR5. Kanamycin-resistant gene and Ole1-GFP for screening of transformants. Please visit https://doi.org/10.1101/2023.02.27.530312 for bioRxiv preprint. | Vector Backbone:pK7WG2; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:34:15 | 2 | |||
|
pRAW-457 Resource Report Resource Website |
RRID:Addgene_200213 | PaCas1, PaCas2-3 | Pseudomonas aeruginosa UCBPP-PA14 | Spectinomycin and Streptomycin | PMID:37710013 | Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | Cas1 H25A mutation | 2026-09-01 09:36:08 | 0 | |
|
pRAW-458 Resource Report Resource Website |
RRID:Addgene_200214 | PaCas1, PaCas2-3 | Pseudomonas aeruginosa UCBPP-PA14 | Spectinomycin and Streptomycin | PMID:37710013 | Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | Cas1 E184A mutation | 2026-09-01 09:36:08 | 0 | |
|
pRAW-459 Resource Report Resource Website |
RRID:Addgene_200215 | PaCas1, PaCas2-3 | Pseudomonas aeruginosa UCBPP-PA14 | Spectinomycin and Streptomycin | PMID:37710013 | Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | Cas1 K214A mutation | 2026-09-01 09:36:08 | 0 | |
|
6xHis-MBP-TEV-mDvl2DEP(416-510)_pCDFduet Resource Report Resource Website |
RRID:Addgene_216387 | Dishevelled-2 | Mus musculus | Spectinomycin and Streptomycin | PMID:35998232 | Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:40:35 | 0 | ||
|
6xHis-MBP-TEV-mDvl2PDZ(264-353)_pCDFduet Resource Report Resource Website 1+ mentions |
RRID:Addgene_216386 | Dishevelled-2 | Mus musculus | Spectinomycin and Streptomycin | PMID:35998232 | Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:40:35 | 1 | ||
|
pYPQ121-mTCBE Resource Report Resource Website |
RRID:Addgene_218172 | TALE-Intron-hA3A-Y130F-DddA full (E1347A)-UGI | Other | Spectinomycin and Streptomycin | PMID:38709858 | Vector Backbone:pYPQ121; Vector Types:Plant Expression, Plastid base editing; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:41:05 | 0 | ||
|
PYPQ121-DdCBE Resource Report Resource Website |
RRID:Addgene_218174 | TALE-Intron-N-DddAtox half (G1397N)-UGI-T2A-TALE-C-DddAtox half (G1397C)-UGI | Other | Spectinomycin and Streptomycin | PMID:38709858 | Vector Backbone:pYPQ121; Vector Types:Plant Expression, Plastid base editing; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:41:05 | 0 | ||
|
pQC Resource Report Resource Website |
RRID:Addgene_221134 | [PibpA-gfpASV] | Synthetic | Spectinomycin and Streptomycin | PMID:38676700 | Backbone Marker:Standard European Vector Architecture; Vector Backbone:pSEVA631; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-09-01 09:41:56 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
