Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LSB-hsa-miR-128-3p Resource Report Resource Website |
RRID:Addgene_103200 | hsa-miR-128-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:59 | 0 | |
|
LSB-hsa-miR-100-5p Resource Report Resource Website |
RRID:Addgene_103164 | hsa-miR-100-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:58 | 0 | |
|
LSB-hsa-miR-100-3p Resource Report Resource Website |
RRID:Addgene_103163 | hsa-miR-100-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:58 | 0 | |
|
LSB-hsa-miR-105-3p Resource Report Resource Website |
RRID:Addgene_103169 | hsa-miR-105-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:58 | 0 | |
|
pUC19-E0XXB7 Resource Report Resource Website |
RRID:Addgene_103098 | E0XXB7(Cas9 coding gene from uncultured delta proteobacterium HF0070_07E19) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-09-01 09:09:57 | 0 | |
|
pUC19-Q927P4 Resource Report Resource Website |
RRID:Addgene_103131 | Q927P4(Cas9 coding gene from Listeria innocua serovar 6a (strain CLIP 11262)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-09-01 09:09:57 | 0 | |
|
pUC19-D6GRK4 Resource Report Resource Website |
RRID:Addgene_103097 | D6GRK4(Cas9 coding gene from Filifactor alocis (strain ATCC 35896 / D40 B5)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-09-01 09:09:57 | 0 | |
|
pUC19-Q73QW6 Resource Report Resource Website 50+ mentions |
RRID:Addgene_103130 | Q73QW6(Cas9 coding gene from Streptococcus mutans serotype c (strain ATCC 700610 / UA159)) | Other | Ampicillin | PMID:29529247 | Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin | human codon-optimized | 2026-09-01 09:09:57 | 70 | |
|
pcDNA3.1-GcACR_457-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_103137 | Anion channelrhodopsin GcACR_457 | Geminigera cryophila | Ampicillin | PMID:28256618 | Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | human codon optimized | 2026-09-01 09:09:57 | 1 | |
|
p413_Csy4NLS Resource Report Resource Website |
RRID:Addgene_103139 | Csy4 | Saccharomyces cerevisiae | Ampicillin | PMID:29161506 | Backbone Marker:ATCC; Backbone Size:5522; Vector Backbone:p413 TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:09:58 | 0 | ||
|
pCMX-PGC1b Resource Report Resource Website |
RRID:Addgene_1032 | PGC-1 beta | Mus musculus | Ampicillin | PMID:11733490 | Backbone Size:0; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:09:59 | 0 | ||
|
pcDNA3.1-G1ACR_203-EYFP Resource Report Resource Website |
RRID:Addgene_103143 | Anion channelrhodopsin G1ACR_203 | Geminigera sp. | Ampicillin | PMID:28256618 | Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | human codon optimized | 2026-09-01 09:09:58 | 0 | |
|
LSB-hsa-let-7a-5p Resource Report Resource Website |
RRID:Addgene_103146 | hsa-let-7a-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:58 | 0 | |
|
LSB-hsa-let-7a-3p Resource Report Resource Website |
RRID:Addgene_103145 | hsa-let-7a-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:58 | 0 | |
|
dCas9v2 Resource Report Resource Website |
RRID:Addgene_103140 | dCas9-VPR | Saccharomyces cerevisiae | Ampicillin | PMID:29161506 | Vector Backbone:pDTU-113; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Removed scaffold gRNA from original plasmid | 2026-09-01 09:09:58 | 0 | |
|
pcDNA3.1-GcACR_439-EYFP Resource Report Resource Website |
RRID:Addgene_103142 | Anion channelrhodopsin GcACR_439 | Geminigera cryophila | Ampicillin | PMID:28256618 | Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | human codon optimized | 2026-09-01 09:09:58 | 0 | |
|
pCRA03 Resource Report Resource Website |
RRID:Addgene_103141 | gRNAs | Saccharomyces cerevisiae | Ampicillin | PMID:29161506 | Vector Backbone:dCas9v2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:09:58 | 0 | ||
|
LSB-hsa-miR-136-5p Resource Report Resource Website |
RRID:Addgene_103231 | hsa-miR-136-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:59 | 0 | |
|
LSB-hsa-miR-139-3p Resource Report Resource Website |
RRID:Addgene_103234 | hsa-miR-139-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:59 | 0 | |
|
LSB-hsa-miR-138-5p Resource Report Resource Website |
RRID:Addgene_103233 | hsa-miR-138-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-09-01 09:09:59 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.