Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Kaniga, et al Gene. 1991 109: 137-141.; Backbone Size:8509; Vector Backbone:pKNG101; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin and Chloramphenicol
Defining Citation: PMID:19843225
Comments: Please note that there are several discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_71298 Copy
Species: Other
Genetic Insert: dGFP
Vector Backbone Description: Backbone Marker:Patrick Salmon; Backbone Size:5000; Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25732825
Comments: Bisei Ohkawara recloned the CHOP promoter for me after a mix-up with the original plasmids. I received the good plasmids from Japan in June 2014.
from:
Division of Neurogenetics,
Center for Neurological Diseases and Cancer,
Nagoya University Graduate School of Medicine
Institute for advanced research Nagoya University (IAR)
65 Tsurumai, Showa-ku, Nagoya 466-8550, Japan.
Proper citation: RRID:Addgene_71299 Copy
Species: changed Cysteine 176 to Alanine
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Proper citation: RRID:Addgene_71360 Copy
Species: Other
Genetic Insert: NLS-2xMCP-2xTagRFP-T
Vector Backbone Description: Vector Backbone:pHsp83; Vector Types:Insect Expression, P element-mediated germline transformation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25792328
Proper citation: RRID:Addgene_71242 Copy
Species: Homo sapiens
Genetic Insert: cortactin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24469447
Comments: silent mutation present at 72nd nucleotide
Proper citation: RRID:Addgene_71365 Copy
Species: Mus musculus
Genetic Insert: E-cadherin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24469447
Proper citation: RRID:Addgene_71366 Copy
Vector Backbone Description: Backbone Marker:Nordeen, 1988 and Promega; Vector Backbone:pXP1 and pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10964627
Comments: Depositor states "A spontaneous single C to A mutation was identified 564 bp upstream of the origin of replication at plasmid position 4660 in pXPM which generated high copy replication. A HindIII/XbaI fragment of pGL3 (Promega) containing the improved luciferase gene Luc+ (Sherf et al.,1994) was cloned into into HindIII/XbaI-cut pXPM."
JM109 are the cells used by the author for pXPG and its derivatives.
Proper citation: RRID:Addgene_71248 Copy
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Comments: Please Note: the HP0518 insert has a C-terminal His tag.
Proper citation: RRID:Addgene_71353 Copy
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Proper citation: RRID:Addgene_71351 Copy
Species: changed Tyrosine 133 to Alanine
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Proper citation: RRID:Addgene_71356 Copy
Species: changed Histidine 155 to Alanine
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Proper citation: RRID:Addgene_71357 Copy
Species: changed Tyrosine 132 to Alanine
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Proper citation: RRID:Addgene_71355 Copy
Species: S. Pyogenes
Genetic Insert: humanized dCas9-KRAB T2A GFP
Vector Backbone Description: Vector Backbone:FUGW; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26501517
Comments: Note: DNA prep concentrations may be low due to the size of this plasmid, so working with low copy protocols, higher starting volumes, or fresh transformants is recommended.
Proper citation: RRID:Addgene_71237 Copy
Species: changed Tryptophan 158 to Alanine
Genetic Insert: HP0518
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26306031
Proper citation: RRID:Addgene_71358 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RMP1
Vector Backbone Description: Backbone Marker:D. Amberg (State University of New York Upstate Medical University, Syracuse, NY; Vector Backbone:pTD125; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16585272
Comments: Plasmid is also called pTD125 GFP:RMP1
Vector is URA, CEN-based.
Construct has: ACT1promoter-GFP-RMP1-ACT1terminator
Proper citation: RRID:Addgene_71386 Copy
Species: Homo sapiens
Genetic Insert: human synapsin promoter-flex switch-dsRed-shscramble
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pUC; Vector Types:Mammalian Expression, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26094607
Comments: this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-shscramble plasmid
All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands.
The insert was read using primers in the dsred sequence:
dsred 410: CGTAATGCAGAAGAAGACTATG
dsred 530R: CCATGTAGATGGACTTGAACTC
Proper citation: RRID:Addgene_71383 Copy
Species: Synthetic
Genetic Insert: CMV promoter-dsRed-mir30-shscramble
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26094607
Comments: this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble
Proper citation: RRID:Addgene_71384 Copy
Species: Drosophila melanogaster
Genetic Insert: Copia
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4526; Vector Backbone:pCoHygro; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_71389 Copy
Species: Homo sapiens
Genetic Insert: GIV/Girdin
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1(-); Vector Types:; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_71544 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: POP1
Vector Backbone Description: Backbone Marker:D. Amberg (State University of New York Upstate Medical University, Syracuse, NY; Vector Backbone:pTD125; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16585272
Comments: Vector is URA, CEN-based.
Construct has: ACT1promoter-GFP-POP1-ACT1terminator
Proper citation: RRID:Addgene_71387 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within nidm-terms that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.