Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAUC40 Resource Report Resource Website |
RRID:Addgene_71298 | Streptomycin and Chloramphenicol | PMID:19843225 | Please note that there are several discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. | Backbone Marker:Kaniga, et al Gene. 1991 109: 137-141.; Backbone Size:8509; Vector Backbone:pKNG101; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin and Chloramphenicol | 2026-08-29 01:09:42 | 0 | |||
|
pCLX-CHOP-dGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_71299 | dGFP | Other | Ampicillin | PMID:25732825 | Bisei Ohkawara recloned the CHOP promoter for me after a mix-up with the original plasmids. I received the good plasmids from Japan in June 2014. from: Division of Neurogenetics, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine Institute for advanced research Nagoya University (IAR) 65 Tsurumai, Showa-ku, Nagoya 466-8550, Japan. | Backbone Marker:Patrick Salmon; Backbone Size:5000; Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 2 | |
|
csd6_13-330_C176A/pET28b(+) N-tag Resource Report Resource Website |
RRID:Addgene_71360 | HP0518 | changed Cysteine 176 to Alanine | Kanamycin | PMID:26306031 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 0 | ||
|
pHsp83-NLS-HA-2xMCP-2xTagRFP-T Resource Report Resource Website 1+ mentions |
RRID:Addgene_71242 | NLS-2xMCP-2xTagRFP-T | Other | Ampicillin | PMID:25792328 | Vector Backbone:pHsp83; Vector Types:Insect Expression, P element-mediated germline transformation; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:41 | 1 | ||
|
Mutant Human Cortactin-GFP Resource Report Resource Website |
RRID:Addgene_71365 | cortactin | Homo sapiens | Kanamycin | PMID:24469447 | silent mutation present at 72nd nucleotide | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | silent mutation present at 72nd nucleotide | 2026-08-29 01:09:42 | 0 |
|
Murine E-cadherin mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_71366 | E-cadherin | Mus musculus | Kanamycin | PMID:24469447 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 2 | ||
|
pXPG Resource Report Resource Website 1+ mentions |
RRID:Addgene_71248 | Ampicillin | PMID:10964627 | Depositor states "A spontaneous single C to A mutation was identified 564 bp upstream of the origin of replication at plasmid position 4660 in pXPM which generated high copy replication. A HindIII/XbaI fragment of pGL3 (Promega) containing the improved luciferase gene Luc+ (Sherf et al.,1994) was cloned into into HindIII/XbaI-cut pXPM." JM109 are the cells used by the author for pXPG and its derivatives. | Backbone Marker:Nordeen, 1988 and Promega; Vector Backbone:pXP1 and pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:41 | 3 | |||
|
csd6_17-330/pET28b(+) N-tag Resource Report Resource Website 1+ mentions |
RRID:Addgene_71353 | HP0518 | Kanamycin | PMID:26306031 | Please Note: the HP0518 insert has a C-terminal His tag. | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 1 | ||
|
csd6_4-330/pET28b(+) N-tag Resource Report Resource Website |
RRID:Addgene_71351 | HP0518 | Kanamycin | PMID:26306031 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 0 | |||
|
csd6_13-330_Y133A/pET28b(+) N-tag Resource Report Resource Website |
RRID:Addgene_71356 | HP0518 | changed Tyrosine 133 to Alanine | Kanamycin | PMID:26306031 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 0 | ||
|
csd6_13-330_H155A/pET28b(+) N-tag Resource Report Resource Website |
RRID:Addgene_71357 | HP0518 | changed Histidine 155 to Alanine | Kanamycin | PMID:26306031 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 0 | ||
|
csd6_13-330_Y132A/pET28b(+) N-tag Resource Report Resource Website |
RRID:Addgene_71355 | HP0518 | changed Tyrosine 132 to Alanine | Kanamycin | PMID:26306031 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 0 | ||
|
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_71237 | humanized dCas9-KRAB T2A GFP | S. Pyogenes | Ampicillin | PMID:26501517 | Note: DNA prep concentrations may be low due to the size of this plasmid, so working with low copy protocols, higher starting volumes, or fresh transformants is recommended. | Vector Backbone:FUGW; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | D10A and H840A | 2026-08-29 01:09:41 | 69 |
|
csd6_13-330_W158A/pET28b(+) N-tag Resource Report Resource Website |
RRID:Addgene_71358 | HP0518 | changed Tryptophan 158 to Alanine | Kanamycin | PMID:26306031 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET28(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:42 | 0 | ||
|
pTG005 Resource Report Resource Website |
RRID:Addgene_71386 | RMP1 | Saccharomyces cerevisiae | Ampicillin | PMID:16585272 | Plasmid is also called pTD125 GFP:RMP1 Vector is URA, CEN-based. Construct has: ACT1promoter-GFP-RMP1-ACT1terminator | Backbone Marker:D. Amberg (State University of New York Upstate Medical University, Syracuse, NY; Vector Backbone:pTD125; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 0 | |
|
pAAV-hysn-flex-dsRed-shscramble Resource Report Resource Website 1+ mentions |
RRID:Addgene_71383 | human synapsin promoter-flex switch-dsRed-shscramble | Homo sapiens | Ampicillin | PMID:26094607 | this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-shscramble plasmid All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands. The insert was read using primers in the dsred sequence: dsred 410: CGTAATGCAGAAGAAGACTATG dsred 530R: CCATGTAGATGGACTTGAACTC | Backbone Size:3000; Vector Backbone:pUC; Vector Types:Mammalian Expression, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 2 | |
|
pPRIME-dsRed-shscramble Resource Report Resource Website |
RRID:Addgene_71384 | CMV promoter-dsRed-mir30-shscramble | Synthetic | Ampicillin | PMID:26094607 | this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble | Vector Backbone:pUC; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 0 | |
|
pCoHygro L16_shRNA of spliced Copia Resource Report Resource Website |
RRID:Addgene_71389 | Copia | Drosophila melanogaster | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4526; Vector Backbone:pCoHygro; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 0 | |||
|
CFP-GIV-WT Resource Report Resource Website |
RRID:Addgene_71544 | GIV/Girdin | Homo sapiens | Ampicillin | Backbone Size:5428; Vector Backbone:pcDNA3.1(-); Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:43 | 0 | |||
|
pTD125 GFP:POP1 Resource Report Resource Website |
RRID:Addgene_71387 | POP1 | Saccharomyces cerevisiae | Ampicillin | PMID:16585272 | Vector is URA, CEN-based. Construct has: ACT1promoter-GFP-POP1-ACT1terminator | Backbone Marker:D. Amberg (State University of New York Upstate Medical University, Syracuse, NY; Vector Backbone:pTD125; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:42 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
