Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: HsRoquin1_1-509
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28165457
Comments: ORF extracted from NCBI: NM_172071.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148612 Copy
Species: Drosophila melanogaster
Genetic Insert: DmGIGYF
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31114929
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148907 Copy
Genetic Insert: SpCas9
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40087133
Comments: Please visit https://doi.org/10.1101/2024.11.24.625072 for bioRxiv preprint.
Proper citation: RRID:Addgene_235165 Copy
Species: Homo sapiens
Genetic Insert: EGFR
Vector Backbone Description: Vector Backbone:pFC220K SmBiT CMV-Blast Flexi Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238754 Copy
Species: Homo sapiens
Genetic Insert: VHL
Vector Backbone Description: Vector Backbone:pFC221K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238752 Copy
Species: Homo sapiens
Genetic Insert: PSMD3
Vector Backbone Description: Vector Backbone:pFN21A HaloTag(R) CMV Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_238750 Copy
Species: Homo sapiens
Genetic Insert: CHRM1
Vector Backbone Description: Vector Backbone:pBiT3.1-N [CMV/HiBiT/Blast] Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_236898 Copy
Species: Homo sapiens
Genetic Insert: IRF5
Vector Backbone Description: Vector Backbone:pFN31K Nluc CMV-neo Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_237150 Copy
Species: Mus musculus
Genetic Insert: Microexon E35a
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin
Comments: Microexon E35a sequence: gagacagagtcagatcaagatgatgag
Proper citation: RRID:Addgene_238353 Copy
Species: Homo sapiens
Genetic Insert: ARHGEF10
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236685 Copy
Species: Homo sapiens
Genetic Insert: KDM6B
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236675 Copy
Species: Homo sapiens
Genetic Insert: ERBIN
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236693 Copy
Species: Homo sapiens
Genetic Insert: RALGAPB
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236667 Copy
Species: Mus musculus
Genetic Insert: The Arl13b noncilium targeting sequence-EGFP-TurboID
Vector Backbone Description: Backbone Size:5382; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38664376
Proper citation: RRID:Addgene_248196 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Vector Backbone:pFN224C NanoLuc(R) CMV-Neo BiBRET-Balanced Vector and pFN222K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238826 Copy
Species: Homo sapiens
Genetic Insert: SRCAP
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_006662,ENST00000262518 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_143713 Copy
Species: Synthetic
Genetic Insert: genes for styrene biosynthesis in S. albus
Vector Backbone Description: Vector Backbone:pAZA4; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37138074
Proper citation: RRID:Addgene_207648 Copy
Species: Synthetic
Genetic Insert: genes for styrene biosynthesis in S. albus
Vector Backbone Description: Vector Backbone:pAZA4; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37138074
Proper citation: RRID:Addgene_207643 Copy
Species: Synthetic
Genetic Insert: 2 copies of evovled P450-T2 mutant gene and genes for styrene biosynthesis in S. albus
Vector Backbone Description: Vector Backbone:pAZA4; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37138074
Proper citation: RRID:Addgene_207645 Copy
Species: Synthetic
Genetic Insert: P450-T2
Vector Backbone Description: Vector Backbone:pBbE7k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37138074
Proper citation: RRID:Addgene_207646 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within nidm-terms that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
