Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Fv-Caspase 8 (C/A)-2A-GFP
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20308068
Proper citation: RRID:Addgene_82713 Copy
Species: Homo sapiens
Genetic Insert: human DNA-PKcs
Vector Backbone Description: Backbone Size:4665; Vector Backbone:pcmv6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16314509
Proper citation: RRID:Addgene_83317 Copy
Species: Other
Genetic Insert: Csy4 hairpin
Vector Backbone Description: Backbone Size:5927; Vector Backbone:TR-GFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26354771
Proper citation: RRID:Addgene_80596 Copy
Species: Synthetic
Genetic Insert: NeoR
Vector Backbone Description: Backbone Size:2964; Vector Backbone:pBS-KS plus (BlueScribe KS Plus); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504702
Proper citation: RRID:Addgene_80759 Copy
Species: Synthetic
Genetic Insert: NeoR
Vector Backbone Description: Backbone Size:2964; Vector Backbone:pBS-KS plus (BlueScribe KS Plus); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504702
Proper citation: RRID:Addgene_80758 Copy
Vector Backbone Description: Backbone Size:6213; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22412018
Proper citation: RRID:Addgene_80901 Copy
Species: Homo sapiens
Genetic Insert: BAP1
Vector Backbone Description: Backbone Marker:Rao lab (Addgene plasmid# 17442); Backbone Size:8200; Vector Backbone:MSCV-IRES-Thy1.1 DEST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26095772
Proper citation: RRID:Addgene_81024 Copy
Genetic Insert: human IL-10
Vector Backbone Description: Vector Backbone:pHR SIN; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27693353
Proper citation: RRID:Addgene_85427 Copy
Species: Homo sapiens
Genetic Insert: BIG1
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Vector Backbone:pcDNA4c; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15385626
Comments: It is tricky to amplify the plasmid. After transformation of the plasmid into E. coli, not only the transformants grow very slowly (usually, it takes more than 20 h for the transformants to form visible colonies on ampicillin‐containing plates and colony size is smaller than usual one), but also their viability is drastically decreased during storage at 4C. Therefore, we routinely use fresh transformants for plasmid preparation. The plasmid yield decreases with the progress of the day after transformation. It is not recommended to make a pre-culture (~ 2ml) from a single colony for large scale culture. We strongly recommend that after transformation and recovery culture (for 1hr at 37C), bring all transformants to large scale culture (~ 200 ml) directly containing ampicillin.
Proper citation: RRID:Addgene_79433 Copy
Genetic Insert: NA
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26829286
Comments: If LacI is added to the cell (e.g., in a plasmid), the expression of RFP will be somewhat repressed (unless if IPTG is added), as there is a lacO between the promoter and the gene's ATG. Attempts to remove this lacO were unsuccessful - we suspect the higher RFP expression might lead to cell death (in the cloning strain, E. coli DH5alpha).
Please note this strain has a higher %GC than E. coli, so PCRing (and sequencing) may be difficult.
Proper citation: RRID:Addgene_79642 Copy
Species: Other
Genetic Insert: OsTIR1
Vector Backbone Description: Backbone Size:5213; Vector Backbone:pBabe; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29804665
Comments: The osTIR1-9Myc was a kind gift from Masato Kanemaki (National Institute of Genetics, Mishima, Japan).
Proper citation: RRID:Addgene_80074 Copy
Species: Homo sapiens
Genetic Insert: H2B-GFP
Vector Backbone Description: Backbone Marker:Bob Weinberg, Addgene plasmid 1764; Backbone Size:5200; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20551166
Comments: H2B-GFP was cloned from pBOS-H2B-GFP (BD Biosciences) into the pBABE retroviral vector.
Proper citation: RRID:Addgene_26790 Copy
Species: Mus musculus
Genetic Insert: autophagy-related 3 (yeast)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20723759
Proper citation: RRID:Addgene_26926 Copy
Species: Homo sapiens
Genetic Insert: eGFPhTERT
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBABEhygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12198499
Proper citation: RRID:Addgene_28169 Copy
Species: Mus musculus
Genetic Insert: mTERT
Vector Backbone Description: Backbone Marker:Bob Weinberg (Addgene Plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21732358
Proper citation: RRID:Addgene_36413 Copy
Genetic Insert: frt-gent-frt
Vector Backbone Description: Backbone Marker:Datensko and Wanner; Vector Backbone:pR6K; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamycin
Defining Citation: PMID:21296953
Comments: frt-gent-frt cassette was cut out of pGEM-frt-gent-frt with EcoRI and ligated into EcoRI digested pR6K. Please note that the R6K ori may be in opposite orientation relative to cassette and annotation since it was not directionally cloned.
Proper citation: RRID:Addgene_45469 Copy
Species: Homo sapiens
Genetic Insert: hDna2
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBabe hygro 3xFLAG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22570476
Comments: to get 3XFLAG hDna2 out cut with BAMH1 and SAL1
Proper citation: RRID:Addgene_31955 Copy
Vector Backbone Description: Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37504 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Vector Backbone Description: Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8R adds a TEV-cleavable strep tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ .
Proper citation: RRID:Addgene_37506 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within nidm-terms that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
