Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 23 showing 441 ~ 460 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_103831

    This resource has 1+ mentions.

http://www.addgene.org/103831

Species: Other
Genetic Insert: MS2 coat protein (MCP)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:pTagRFP_C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: relevance of mutations unknown, but insert sequence is almost identical (except A88G, I30V) to another published MCP sequence (GenBank: JQ624676.1, Auslaender et al. 2012, Nature 487(7405): 123-127)

Proper citation: RRID:Addgene_103831 Copy   


  • RRID:Addgene_103728

http://www.addgene.org/103728

Species: Homo sapiens
Genetic Insert: hsa-miR-758-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103728 Copy   


  • RRID:Addgene_103729

http://www.addgene.org/103729

Species: Homo sapiens
Genetic Insert: hsa-miR-758-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103729 Copy   


  • RRID:Addgene_103726

http://www.addgene.org/103726

Species: Homo sapiens
Genetic Insert: hsa-miR-744-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103726 Copy   


  • RRID:Addgene_103725

http://www.addgene.org/103725

Species: Homo sapiens
Genetic Insert: hsa-miR-708-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103725 Copy   


  • RRID:Addgene_103720

http://www.addgene.org/103720

Species: Homo sapiens
Genetic Insert: hsa-miR-675-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103720 Copy   


  • RRID:Addgene_103722

http://www.addgene.org/103722

Species: Homo sapiens
Genetic Insert: hsa-miR-7-1-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103722 Copy   


  • RRID:Addgene_103721

http://www.addgene.org/103721

Species: Homo sapiens
Genetic Insert: hsa-miR-675-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103721 Copy   


  • RRID:Addgene_103816

http://www.addgene.org/103816

Species: Arabidopsis thaliana
Genetic Insert: CIBN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4672; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_103816 Copy   


  • RRID:Addgene_103815

http://www.addgene.org/103815

Species: Arabidopsis thaliana
Genetic Insert: CIBN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_103815 Copy   


  • RRID:Addgene_103818

    This resource has 1+ mentions.

http://www.addgene.org/103818

Species: Arabidopsis thaliana
Genetic Insert: PHR-iRFP713
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Switched iRFP713 (PCR on Addgene #31857) for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866) using AgeI & NotI (AgeI site destroyed)

Proper citation: RRID:Addgene_103818 Copy   


  • RRID:Addgene_103817

    This resource has 1+ mentions.

http://www.addgene.org/103817

Species: Arabidopsis thaliana
Genetic Insert: PHR-EYFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Switched EYFP for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866)

Proper citation: RRID:Addgene_103817 Copy   


  • RRID:Addgene_103812

    This resource has 1+ mentions.

http://www.addgene.org/103812

Species: Homo sapiens
Genetic Insert: CIBN-hTRF2-tagRFP-T
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: EGFP was cut out from the backbone (NheI/BamHI cuts)

Proper citation: RRID:Addgene_103812 Copy   


  • RRID:Addgene_103778

http://www.addgene.org/103778

Species: Synthetic
Genetic Insert: YFP-SspBx6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_103778 Copy   


  • RRID:Addgene_103811

http://www.addgene.org/103811

Species: Homo sapiens
Genetic Insert: CIBN-hTRF1-tagRFP-T
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: EGFP was cut out from the backbone (NheI/BamHI cuts)

Proper citation: RRID:Addgene_103811 Copy   


  • RRID:Addgene_103814

http://www.addgene.org/103814

Species: Arabidopsis thaliana
Genetic Insert: CIBN-LacI
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: EGFP was cut out from the backbone (NheI/BamHI cuts); relevance of mutations unknown

Proper citation: RRID:Addgene_103814 Copy   


  • RRID:Addgene_103826

http://www.addgene.org/103826

Species: Homo sapiens
Genetic Insert: PHR-EYFP-hGCN5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: mCherry was cut out from the backbone (XhoI/XbaI cuts); relevance of mutations unknown; amplified by PCR from Addgene #14106

Proper citation: RRID:Addgene_103826 Copy   


  • RRID:Addgene_103829

http://www.addgene.org/103829

Species: Homo sapiens
Genetic Insert: PHR-EYFP-hHP1β
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: mCherry was cut out from the backbone (XhoI/XbaI cuts)

Proper citation: RRID:Addgene_103829 Copy   


http://www.addgene.org/103782

Species: Synthetic
Genetic Insert: TIA1 RRM-mCherry-iLIDx6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4717; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_103782 Copy   


http://www.addgene.org/103783

Species: Synthetic
Genetic Insert: TIA1 RRM-CFP-FRBx5
Vector Backbone Description: Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103783 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within nidm-terms that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X