Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,343 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pNH034
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42150 RT-cassette Synthetic Chloramphenicol and Tetracycline PMID:23281894 Single-copy vector under non-induced condition enabling stable propagation of RT-cassette. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:7904; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-07-25 12:46:58 1
pmyc-GFP-TNRC6A-del.GW-I
 
Resource Report
Resource Website 		RRID:Addgene_42030 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted aa457-532 2026-07-25 12:46:57 0
pMYC-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42142 c-Myc Homo sapiens Ampicillin PMID:21668996 Backbone Marker:Invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP-TOPO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:58 1
pCMV-N1-mouse-superfolderGFP (mGRASP)
 
Resource Report
Resource Website 		RRID:Addgene_42143 pCMV-N1-superfolderGFP Synthetic Kanamycin PMID:22355283 Vector Backbone:pNICE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:58 0
pNH002
 
Resource Report
Resource Website 		RRID:Addgene_42145 N-TAP TAG::[(G4S)3]::mTFP1 Caenorhabditis elegans Ampicillin PMID:23281894 Nb. CDS terminates with two in-frame stop codons [TAA-TAG] Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:58 0
pNH009
 
Resource Report
Resource Website 		RRID:Addgene_42146 N-TAP-tag::mTFP1 Caenorhabditis elegans Ampicillin PMID:23281894 Nb. CDS terminates with two in-frame stop codons [TAA-TAG] Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:58 0
pNH013
 
Resource Report
Resource Website 		RRID:Addgene_42147 mTFP1 Caenorhabditis elegans Ampicillin PMID:23281894 Nb. CDS terminates with two in-frame stop codons [TAA-TAG] Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-07-25 12:46:58 0
pRK5-mFzd7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42259 Frizzled 7 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:59 4
MLM3639
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42252 Streptococcus pyogenes Cas9-3X Flag Ampicillin PMID:23360964 Plasmid Features: CAG enhancer-CMV promoter = 7466-370 Cas9 = 409-4512 NLS = 4519-4539 3X FLAG = 4546-4611 BGHpA = 4612-4839 Vector Backbone:unknown; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:59 1
pRK5-mFzd2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42254 Frizzled 2 Mus musculus Ampicillin PMID:23095888 Fzd2 insert contains S193A compared with NM_020510.2. Mutation has no effect on plasmid function Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:59 2
pRK5-mFzd4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42256 Frizzled 4 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:59 3
pRK5-mFzd6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42258 Frizzled 6 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:59 3
DR274
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_42250 Kanamycin PMID:23360964 Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:59 211
Zebrafish-gRNA-0008
 
Resource Report
Resource Website 		RRID:Addgene_42248 gRNA-tia1l Danio rerio Kanamycin PMID:23360964 Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:59 0
pCS6-mPSD95a-TS2-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42240 PSD95 Ampicillin PMID:23103964 Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:59 2
Zebrafish-gRNA-0002
 
Resource Report
Resource Website 		RRID:Addgene_42242 gRNA-drd3 Danio rerio Kanamycin PMID:23360964 Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:59 0
Zebrafish-gRNA-0003
 
Resource Report
Resource Website 		RRID:Addgene_42243 gRNA-fh site #1 Danio rerio Kanamycin PMID:23360964 Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:59 0
Zebrafish-gRNA-0006
 
Resource Report
Resource Website 		RRID:Addgene_42246 gRNA-rgs4 Danio rerio Kanamycin PMID:23360964 Target site: GGAGAAGGTGAAGGACACTG Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:59 0
pENTR-3xFLAG-YAP1-S127A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42239 YAP1 Homo sapiens Kanamycin PMID:22308401 Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Serine 127 changed to alanine 2026-07-25 12:46:59 1
pcDNA3 βarr1 S412D Flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_42196 β-arrestin 1 S412D Rattus norvegicus Ampicillin PMID:9924018 Flag epitope-tagged truncation mutants of β-arrestin 1 were prepared by the polymerase chain reaction (PCR), incorporating an Eco RI site, minimal Kozak sequence (ACC), and initiator methionine codon into the 5' primer, and the Flag epitope sequence, stop codon, and an Xho I site into the 3' primer. PCR products were subcloned into pcDNA3. DNA sequences were confirmed by dideoxynucleotide sequencing. Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S412D 2026-07-25 12:46:58 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDM Terminology Resources

    Welcome to the nidm-terms Resources search. From here you can search through a compilation of resources used by nidm-terms and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that nidm-terms has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on nidm-terms then you can log in from here to get additional features in nidm-terms such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into nidm-terms you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

NIDM Terminology

Recent News Entries

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch