Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00035145
Proper Citation: RRID:WB-STRAIN:WBStrain00035145
Description: Caenorhabditis elegans with name sea-1(y356) II. from WB.
Species: Caenorhabditis elegans
Synonyms: sea-1(y356) II.
Notes: Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.
Affected Gene: WBGene00004750(sea-1)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for TY3579.
No alerts have been found for TY3579.
Source: Integrated Animals
Source Database: WormBase (WB)
