Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/86856
Proper Citation: RRID:Addgene_86856
Insert Name: Androgen receptor (AR)
Organism: Homo sapiens
Bacterial Resistance: Kanamycin
Defining Citation: PMID:27699828
Vector Backbone Description: Backbone Marker:Clontech (Takara); Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The poly-glutamine repeat region in this plasmid is known to be unstable and the exact number of repeats may vary. However, repeats of 18-26 glutamines are all considered wildtype. Screen multiple colonies to ensure isolation of a plasmid with a suitable number of repeats. Prostate. 2013 February 15; 73(3): 267–277. doi:10.1002/pros.22566. The activity of the androgen receptor variant AR-V7 is regulated by FOXO1 in a PTEN-PI3K-AKT-dependent way. Cloning is described in the supplemental materials (excerpted below). Cloning Strategy The carboxy-terminal part of AR-V7 and AR-V1 were PCR amplified by using the following primers: sense (common for AR-V1 and AR-V7 amplification) 5’-GCGCAAGCTTCTGGGTGTCACTATGGAGC (harboring a Hind III site), antisense for AR-V7 GCTCTAGATCAGGGTCTGGTCATTTTGAGATGC (harboring a XbaI site), antisense for AR-V1 GCTCTAGATTAAGGAAGCCATTCTGAGACTCC (also harboring a XbaI site). CMV-AR-V7 and CMV-AR-V1 were generated by replacing a HindIII-XbaI cDNA fragment encoding the carboxy-terminal portion of wild-type AR (subcloned into a pcDNA3 plasmid) with the AR-V7 or AR-V1 fragments generated by PCR. GFP-AR-V7 and GFP-AR-V1 were generated by replacing an XmaI-XbaI cDNA fragment encoding the carboxy-terminal part of wild-type AR, subcloned in frame to the green fluorescent protein of plasmid pEGFP-c1, with XmaI-XbaI fragments from the pcDNA3 plasmids containing the AR-V7 and AR-V1 variants.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pEGFP-C1-AR V7.
No alerts have been found for pEGFP-C1-AR V7.
Source: Addgene