Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/48329
Proper Citation: RRID:Addgene_48329
Bacterial Resistance: Spectinomycin
Vector Backbone Description: Backbone Size:3939; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Sumo fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression.13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET His6 Sumo TEV co-transformation cloning vector (13S-S).
No alerts have been found for pET His6 Sumo TEV co-transformation cloning vector (13S-S).
Source: Addgene