Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/41730
Proper Citation: RRID:Addgene_41730
Insert Name: Notch-1 Intracellular Domain
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:9620803
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Alternate plasmid name: pCS2 NICv1744-6MT To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCS2 Notch1 ICv-6MT.
No alerts have been found for pCS2 Notch1 ICv-6MT.
Source: Addgene
