Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
RRID:Addgene_107253 RRID Copied  
PDF Report How to cite
RRID:Addgene_107253
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/107253

Proper Citation: RRID:Addgene_107253

Insert Name: RNA motif plasmid cloning backbone

Bacterial Resistance: Ampicillin

Defining Citation: PMID:29400715

Vector Backbone Description: Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin

Comments: Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs. Oligo cloning can be performed similarly to sgRNA cloning. Primers to order: Primers (5'->3') F GCTT R AGCT Example to clone in motif IRE motif IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA Primers to order F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for RNA motif plasmid cloning backbone.

No alerts have been found for RNA motif plasmid cloning backbone.

Data and Source Information

Source: Addgene