Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/104590
Proper Citation: RRID:Addgene_104590
Insert Name: 2LTR circle junction of HIV-1
Organism: HIV-1 virus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:18762215
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3001; Vector Backbone:pGemT; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Comments: During HIV-1 infection, unintegrated viral cDNA may be circularized. The circularization generates a unique junction between the long terminal repeat (LTR) ends. HIV-1 2LTR circles have been quantified as measure of viral replication or entry of the viral cDNA into the host cell nucleus. The amplicon is 2672-2879 in the Addgene sequence file. This corresponds to HIV-1 strain HXB2 reference genome 9585-9719 bp (Addgene 2672-2806 bp) fused to 1 to 51 bp (Addgene 2829-2879 bp). In this plasmid there are 22 bp (Addgene 2807-2828 bp) of random sequence inserted between the HIV-1 ends. The insert may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), MH536 (5' TCCACAGATCAAGGATATCTTGTC), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pG-HIV-2LTR.
No alerts have been found for pG-HIV-2LTR.
Source: Addgene
