Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/71383
Proper Citation: RRID:Addgene_71383
Insert Name: human synapsin promoter-flex switch-dsRed-shscramble
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:26094607
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pUC; Vector Types:Mammalian Expression, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-shscramble plasmid All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands. The insert was read using primers in the dsred sequence: dsred 410: CGTAATGCAGAAGAAGACTATG dsred 530R: CCATGTAGATGGACTTGAACTC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pAAV-hysn-flex-dsRed-shscramble.
No alerts have been found for pAAV-hysn-flex-dsRed-shscramble.
Source: Addgene