Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/67171
Proper Citation: RRID:Addgene_67171
Insert Name: HA
Organism: Synthetic
Bacterial Resistance: Ampicillin
Defining Citation: PMID:27465542
Vector Backbone Description: Backbone Marker:Veit Hornung group; Vector Backbone:pCRISPaint; Vector Types:; Bacterial Resistance:Ampicillin
Comments: please check ip situation sequence with: TTCGCTATTACGCCAGCTGGCGA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCRISPaint-HA.
No alerts have been found for pCRISPaint-HA.
Source: Addgene