Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/193852
Proper Citation: RRID:Addgene_193852
Insert Name: Guide RNA
Organism: Synthetic
Bacterial Resistance: Ampicillin
Defining Citation: PMID:37401921
Vector Backbone Description: Backbone Size:2372; Vector Backbone:pZCS2; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pMS84 (U6p::GGACAGTCCTGCCGAGGTGG).
No alerts have been found for pMS84 (U6p::GGACAGTCCTGCCGAGGTGG).
Source: Addgene
